RchiOBHm_Chr6g0277071

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000949
Physical Location & Seq
Reverse (-)
39451524 .. 39455482
3959 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24855

Sequence Viewer

Length: 228 bp
ATGTATAGCAGGAACGCCGTCCTATGGTTTCTTTTGCACCGAAATCATGCACTCGCCGCCGCCGAAGCTATAACTCCAAACCTTCATAACCAATTTTGGGTGTCAACTCCAATTCATAAGATACAAAGGACCTCCGAGCTAAAAAGTGGAAATGAACTCACAAATGGAAAGAGGAGCTTGCGAAAGTCTAGGGGAGCAAAAATGAGAAACAATGAGCCACAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.66

Weight (kDa)

11.36

Isoelectric Point (pI)

44.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 57, 60
AfiI CCNNNNNNNGG 2 cut(s) 24, 97
AluBI AGCT 3 cut(s) 68, 139, 177
AluI AGCT 3 cut(s) 68, 139, 177
AspS9I GGNCC 1 cut(s) 129
AvaII GGWCC 1 cut(s) 129
BceAI ACGGC 1 cut(s) 2
BfaI CTAG 1 cut(s) 189
BisI GCNGC 2 cut(s) 57, 60
BlsI GCNGC 2 cut(s) 58, 61
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 97
BseLI CCNNNNNNNGG 2 cut(s) 24, 97
BseRI GAGGAG 1 cut(s) 187
BslI CCNNNNNNNGG 2 cut(s) 24, 97
BspACI CCGC 2 cut(s) 57, 60
BstC8I GCNNGC 1 cut(s) 179
BstMWI GCNNNNNNNGC 2 cut(s) 56, 65
Cac8I GCNNGC 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 129
CviAII CATG 1 cut(s) 47
CviJI RGCY 4 cut(s) 68, 139, 177, 217
CviKI_1 RGCY 4 cut(s) 68, 139, 177, 217
Eco47I GGWCC 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 129
FaeI CATG 1 cut(s) 50
FaiI YATR 6 cut(s) 6, 25, 48, 71, 87, 117
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FatI CATG 1 cut(s) 46
Fnu4HI GCNGC 2 cut(s) 57, 60
Fsp4HI GCNGC 2 cut(s) 57, 60
FspBI CTAG 1 cut(s) 189
GluI GCNGC 2 cut(s) 57, 60
Hin1II CATG 1 cut(s) 50
HincII GTYRAC 1 cut(s) 105
HindII GTYRAC 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 136
Hpy8I GTNNAC 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 37, 50
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 65
Hsp92II CATG 1 cut(s) 50
LmnI GCTCC 2 cut(s) 174, 194
MaeI CTAG 1 cut(s) 189
MluCI AATT 2 cut(s) 92, 111
MnlI CCTC 2 cut(s) 142, 165
MslI CAYNNNNRTG 1 cut(s) 223
MwoI GCNNNNNNNGC 2 cut(s) 56, 65
NlaIII CATG 1 cut(s) 50
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PkrI GCNGC 2 cut(s) 58, 61
PpuMI RGGWCCY 1 cut(s) 129
Psp5II RGGWCCY 1 cut(s) 129
PspPI GGNCC 1 cut(s) 129
PspPPI RGGWCCY 1 cut(s) 129
RseI CAYNNNNRTG 1 cut(s) 223
SatI GCNGC 2 cut(s) 57, 60
Sau96I GGNCC 1 cut(s) 129
SetI ASST 5 cut(s) 70, 84, 134, 141, 179
SgeI CNNG 6 cut(s) 22, 59, 65, 148, 190, 201
SinI GGWCC 1 cut(s) 129
SmiMI CAYNNNNRTG 1 cut(s) 223
Sse9I AATT 2 cut(s) 92, 111
SsiI CCGC 2 cut(s) 57, 60
SspMI CTAG 1 cut(s) 189
TasI AATT 2 cut(s) 92, 111
TauI GCSGC 2 cut(s) 59, 62
TspDTI ATGAA 3 cut(s) 74, 104, 168
VpaK11BI GGWCC 1 cut(s) 129
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.