Rh4BG121400

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0000949
Physical Location & Seq
Reverse (-)
20327044 .. 20327355
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG121400.1

Sequence Viewer

Length: 312 bp
ATGAGAAACCTGGAGAAAAGAGCCGTCAGGGATAAAAGGAAGAGAGACGTTGAGGCCAAGACAATTGAGGCCATTTTGGCAGAAATTGCTCAACTAACACCAACTCTAGTCGAAACTACTAGGATCCCAAAAACCCCTTCATCCACTAAGCTCCACATGCCAGCTCATTTCATGGTTGACACTATCCTAGTCAACCTTCCTAGCACTGAGAGTGTGATGGTGACCTCTACTGAAGACAAGGACGAGGATGAAGCTTCAGTGACTCAGGAGTCCACTACGTCTTCACAAGAAGGCCAAAACGTTGACCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

103

Amino Acids

11.47

Weight (kDa)

4.99

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 268
AclI AACGTT 1 cut(s) 300
AclWI GGATC 2 cut(s) 118, 131
AcuI CTGAAG 2 cut(s) 240, 252
AjnI CCWGG 1 cut(s) 9
AjuI GAANNNNNNNTTGG 2 cut(s) 121, 153
AluBI AGCT 3 cut(s) 151, 164, 254
AluI AGCT 3 cut(s) 151, 164, 254
Alw26I GTCTC 1 cut(s) 39
AlwI GGATC 2 cut(s) 118, 131
AoxI GGCC 3 cut(s) 54, 69, 292
AsuHPI GGTGA 1 cut(s) 232
BamHI GGATCC 1 cut(s) 123
BbsI GAAGAC 2 cut(s) 240, 273
BccI CCATC 1 cut(s) 211
BceAI ACGGC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 5 cut(s) 107, 120, 188, 201, 310
BglI GCCNNNNNGGC 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 11
BmiI GGNNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 11
BpiI GAAGAC 2 cut(s) 240, 273
BpmI CTGGAG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 11
BseGI GGATG 2 cut(s) 140, 253
BseMII CTCAG 2 cut(s) 198, 278
BshFI GGCC 3 cut(s) 56, 71, 294
BsmAI GTCTC 1 cut(s) 39
BsmBI CGTCTC 1 cut(s) 39
BsnI GGCC 3 cut(s) 56, 71, 294
Bsp143I GATC 1 cut(s) 123
BspANI GGCC 3 cut(s) 56, 71, 294
BspCNI CTCAG 2 cut(s) 199, 277
BspLI GGNNCC 1 cut(s) 125
BspPI GGATC 2 cut(s) 118, 131
BssMI GATC 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 11
Bst6I CTCTTC 1 cut(s) 35
BstAPI GCANNNNNTGC 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 3 cut(s) 147, 207, 264
BstEII GGTNACC 1 cut(s) 220
BstF5I GGATG 2 cut(s) 140, 253
BstKTI GATC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 1 cut(s) 123
BstMWI GCNNNNNNNGC 3 cut(s) 77, 86, 157
BstNI CCWGG 1 cut(s) 11
BstNSI RCATGY 1 cut(s) 160
BstPI GGTNACC 1 cut(s) 220
BstSCI CCNGG 1 cut(s) 9
BstV2I GAAGAC 2 cut(s) 240, 273
BstX2I RGATCY 1 cut(s) 123
BstYI RGATCY 1 cut(s) 123
BsuRI GGCC 3 cut(s) 56, 71, 294
BtsCI GGATG 2 cut(s) 140, 253
BtsIMutI CAGTG 2 cut(s) 204, 264
Cac8I GCNNGC 1 cut(s) 162
CviAII CATG 2 cut(s) 157, 172
CviJI RGCY 7 cut(s) 23, 56, 71, 151, 164, 254, 294
CviKI_1 RGCY 7 cut(s) 23, 56, 71, 151, 164, 254, 294
DdeI CTNAG 3 cut(s) 147, 207, 264
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
DrdI GACNNNNNNGTC 1 cut(s) 268
DseDI GACNNNNNNGTC 1 cut(s) 268
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco57I CTGAAG 2 cut(s) 240, 252
Eco91I GGTNACC 1 cut(s) 220
EcoO65I GGTNACC 1 cut(s) 220
EcoRII CCWGG 1 cut(s) 9
Esp3I CGTCTC 1 cut(s) 39
FaeI CATG 2 cut(s) 160, 175
FaiI YATR 2 cut(s) 158, 173
FatI CATG 2 cut(s) 156, 171
FokI GGATG 2 cut(s) 127, 260
FspBI CTAG 5 cut(s) 107, 120, 188, 201, 310
GsuI CTGGAG 1 cut(s) 32
HaeIII GGCC 3 cut(s) 56, 71, 294
Hin1II CATG 2 cut(s) 160, 175
HincII GTYRAC 3 cut(s) 178, 193, 304
HindII GTYRAC 3 cut(s) 178, 193, 304
HindIII AAGCTT 1 cut(s) 252
HinfI GANTC 2 cut(s) 262, 269
HphI GGTGA 1 cut(s) 232
Hpy166II GTNNAC 4 cut(s) 178, 193, 273, 304
Hpy188III TCNNGA 1 cut(s) 266
Hpy8I GTNNAC 4 cut(s) 178, 193, 273, 304
HpyAV CCTTC 3 cut(s) 147, 206, 284
HpyCH4IV ACGT 3 cut(s) 48, 278, 300
HpyF10VI GCNNNNNNNGC 3 cut(s) 77, 86, 157
HpyF3I CTNAG 3 cut(s) 147, 207, 264
HpySE526I ACGT 3 cut(s) 48, 278, 300
Hsp92II CATG 2 cut(s) 160, 175
Kzo9I GATC 1 cut(s) 123
LmnI GCTCC 1 cut(s) 156
LpnPI CCDG 4 cut(s) 13, 23, 174, 251
MaeI CTAG 5 cut(s) 107, 120, 188, 201, 310
MaeII ACGT 3 cut(s) 48, 278, 300
MaeIII GTNAC 2 cut(s) 220, 259
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 3 cut(s) 52, 245, 273
MfeI CAATTG 1 cut(s) 63
MflI RGATCY 1 cut(s) 123
MluCI AATT 2 cut(s) 63, 84
MlyI GAGTC 2 cut(s) 256, 278
MnlI CCTC 4 cut(s) 46, 61, 235, 238
MspR9I CCNGG 1 cut(s) 11
MunI CAATTG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 3 cut(s) 77, 86, 157
NdeII GATC 1 cut(s) 123
NlaIII CATG 2 cut(s) 160, 175
NlaIV GGNNCC 1 cut(s) 125
NmuCI GTSAC 2 cut(s) 220, 259
NspI RCATGY 1 cut(s) 160
PleI GAGTC 2 cut(s) 256, 277
PpsI GAGTC 2 cut(s) 256, 277
Psp1406I AACGTT 1 cut(s) 300
Psp6I CCWGG 1 cut(s) 9
PspEI GGTNACC 1 cut(s) 220
PspGI CCWGG 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 125
PsuI RGATCY 1 cut(s) 123
Sau3AI GATC 1 cut(s) 123
SchI GAGTC 2 cut(s) 256, 278
ScrFI CCNGG 1 cut(s) 11
SetI ASST 9 cut(s) 12, 51, 153, 166, 198, 227, 256, 281, 303
Sse9I AATT 2 cut(s) 63, 84
SspMI CTAG 5 cut(s) 107, 120, 188, 201, 310
StyD4I CCNGG 1 cut(s) 9
TaiI ACGT 3 cut(s) 51, 281, 303
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 63, 84
TscAI CASTG 2 cut(s) 211, 264
TseFI GTSAC 2 cut(s) 220, 259
Tsp45I GTSAC 2 cut(s) 220, 259
TspDTI ATGAA 3 cut(s) 129, 160, 264
TspRI CASTG 2 cut(s) 211, 264
XceI RCATGY 1 cut(s) 160
XspI CTAG 5 cut(s) 107, 120, 188, 201, 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.