Rh1CG071900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
14822286 .. 14822576
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG071900.1

Sequence Viewer

Length: 291 bp
ATGGTTAGCACGATACCGGTCTACTTACCCAGCATAGAGACCGTGATGGTAACTTTGGCCAAGGGAAATGATGAAGATGACAAAATTTCAAAGGATGAATATGAAGATCAGACTTCAGGTGAAACCTCACAAAGGTCCACCATGTCCTCACAACAGGCAACATCACAAGAGAGTCAAGAGCTTAACCCAAAGAAATTAGTTAAAAACAAGGAATATCCAGCATATGGAGATGACTATTATCCAGGACCAATTACCAGCAATATGACTAAGAAGATAACACTTGGTACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.67

Weight (kDa)

4.59

Isoelectric Point (pI)

48.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 224
AccI GTMKAC 1 cut(s) 21
AcoI YGGCCR 1 cut(s) 57
AcsI RAATTY 1 cut(s) 84
AcuI CTGAAG 1 cut(s) 99
AfaI GTAC 1 cut(s) 286
AfiI CCNNNNNNNGG 2 cut(s) 132, 224
AgeI ACCGGT 1 cut(s) 16
AgsI TTSAA 1 cut(s) 90
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 32
AoxI GGCC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 84
AsiGI ACCGGT 1 cut(s) 16
AspS9I GGNCC 2 cut(s) 135, 245
AsuHPI GGTGA 1 cut(s) 131
AvaII GGWCC 2 cut(s) 135, 245
BalI TGGCCA 1 cut(s) 59
BccI CCATC 1 cut(s) 40
BciT130I CCWGG 1 cut(s) 243
BcoDI GTCTC 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 2 cut(s) 135, 245
BmgT120I GGNCC 2 cut(s) 135, 245
BmrFI CCNGG 1 cut(s) 243
BsaI GGTCTC 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 60
BsaWI WCCGGW 1 cut(s) 16
Bsc4I CCNNNNNNNGG 2 cut(s) 132, 224
Bse118I RCCGGY 1 cut(s) 16
BseBI CCWGG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 60
BseGI GGATG 1 cut(s) 100
BseLI CCNNNNNNNGG 2 cut(s) 132, 224
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 1 cut(s) 59
BshTI ACCGGT 1 cut(s) 16
BsiSI CCGG 1 cut(s) 17
BslI CCNNNNNNNGG 2 cut(s) 132, 224
BsmAI GTCTC 1 cut(s) 32
BsnI GGCC 1 cut(s) 59
Bso31I GGTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 106
BspANI GGCC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 32
BsrFI RCCGGY 1 cut(s) 16
BssAI RCCGGY 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 106
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 267
BstENI CCTNNNNNAGG 1 cut(s) 130
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BsuRI GGCC 1 cut(s) 59
BtsCI GGATG 1 cut(s) 100
Cfr10I RCCGGY 1 cut(s) 16
Cfr13I GGNCC 2 cut(s) 135, 245
Csp6I GTAC 1 cut(s) 285
CspAI ACCGGT 1 cut(s) 16
CviAII CATG 1 cut(s) 142
CviJI RGCY 2 cut(s) 59, 181
CviKI_1 RGCY 2 cut(s) 59, 181
CviQI GTAC 1 cut(s) 285
DdeI CTNAG 1 cut(s) 267
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 32
Eco47I GGWCC 2 cut(s) 135, 245
Eco57I CTGAAG 1 cut(s) 99
EcoNI CCTNNNNNAGG 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 145
FaiI YATR 7 cut(s) 35, 102, 143, 223, 225, 263, 289
FatI CATG 1 cut(s) 141
FauNDI CATATG 1 cut(s) 223
FblI GTMKAC 1 cut(s) 21
FokI GGATG 1 cut(s) 107
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 59
HapII CCGG 1 cut(s) 17
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 172
HpaII CCGG 1 cut(s) 17
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 22, 138
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 2 cut(s) 22, 138
HpyCH4III ACNGT 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 267
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 8 cut(s) 30, 43, 102, 140, 228, 231, 255, 268
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 3 cut(s) 86, 116, 283
MlsI TGGCCA 1 cut(s) 59
MluCI AATT 3 cut(s) 84, 194, 249
MluNI TGGCCA 1 cut(s) 59
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 2 cut(s) 136, 157
Mox20I TGGCCA 1 cut(s) 59
MscI TGGCCA 1 cut(s) 59
MseI TTAA 2 cut(s) 183, 201
Msp20I TGGCCA 1 cut(s) 59
MspI CCGG 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
NdeI CATATG 1 cut(s) 223
NdeII GATC 1 cut(s) 106
NlaIII CATG 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 224
PfoI TCCNGGA 1 cut(s) 241
PinAI ACCGGT 1 cut(s) 16
PleI GAGTC 1 cut(s) 180
PpsI GAGTC 1 cut(s) 180
Psp6I CCWGG 1 cut(s) 241
PspFI CCCAGC 1 cut(s) 29
PspGI CCWGG 1 cut(s) 241
PspPI GGNCC 2 cut(s) 135, 245
RsaI GTAC 1 cut(s) 286
RsaNI GTAC 1 cut(s) 285
SaqAI TTAA 2 cut(s) 183, 201
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 2 cut(s) 135, 245
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 243
SetI ASST 4 cut(s) 121, 128, 137, 183
SinI GGWCC 2 cut(s) 135, 245
Sse9I AATT 3 cut(s) 84, 194, 249
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 43
TasI AATT 3 cut(s) 84, 194, 249
Tru1I TTAA 2 cut(s) 183, 201
Tru9I TTAA 2 cut(s) 183, 201
TspDTI ATGAA 3 cut(s) 87, 111, 117
Van91I CCANNNNNTGG 1 cut(s) 224
VpaK11BI GGWCC 2 cut(s) 135, 245
XagI CCTNNNNNAGG 1 cut(s) 130
XapI RAATTY 1 cut(s) 84
XmiI GTMKAC 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.