Rh1BG092000

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0000949
Physical Location & Seq
Reverse (-)
14743214 .. 14755170
11957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG092000.1

Sequence Viewer

Length: 336 bp
ATGTCTTTCGTACTTAGCCACGCACCAGTCACCCGTAGCATGACAAAGTCAAAGCTCGGAGCAAAGCGGGACAAGAAGGCGGTGAAGGTTGTCAAGACACAAATCGTCAAGACCCCTTCTAAAAATGCCTTGAGAAACCAGAGGAAGAGAGCATCCTGGGCTCAAAGAAAGAGGAATGCTGAGGCCAAGACAATTGAGGCCATTTTAGCAGAGATTGCTCATTTGACGCCGTCCGTGGCTGAAACTGCCAAGGTCCCTAAGGCTTTTCCAGCCACCAAGACCCACATGCCAGCCCATTTCATGCTTCAATGCCGAAGTACATCAAAGCAAGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

111

Amino Acids

12.35

Weight (kDa)

11.17

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 67, 80
AcyI GRCGYC 1 cut(s) 227
AfaI GTAC 2 cut(s) 12, 319
AgsI TTSAA 1 cut(s) 308
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AoxI GGCC 2 cut(s) 183, 198
AspS9I GGNCC 1 cut(s) 253
AsuHPI GGTGA 2 cut(s) 22, 94
AvaII GGWCC 1 cut(s) 253
AxyI CCTNAGG 1 cut(s) 258
BanII GRGCYC 1 cut(s) 163
BbvCI CCTCAGC 1 cut(s) 180
BceAI ACGGC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 157
Bme18I GGWCC 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 1 cut(s) 161
Bpu10I CCTNAGC 1 cut(s) 180
BpuEI CTTGAG 1 cut(s) 151
BsaHI GRCGYC 1 cut(s) 227
BsaJI CCNNGG 3 cut(s) 156, 234, 249
Bse1I ACTGG 1 cut(s) 26
Bse21I CCTNAGG 1 cut(s) 258
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 3 cut(s) 156, 234, 249
BseGI GGATG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 1 cut(s) 26
BshFI GGCC 2 cut(s) 185, 200
BslFI GGGAC 2 cut(s) 83, 239
BsmFI GGGAC 2 cut(s) 83, 239
BsmI GAATGC 1 cut(s) 181
BsnI GGCC 2 cut(s) 185, 200
Bsp1286I GDGCHC 1 cut(s) 163
BspACI CCGC 2 cut(s) 67, 80
BspANI GGCC 2 cut(s) 185, 200
BspCNI CTCAG 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 255
BsrI ACTGG 1 cut(s) 26
BssECI CCNNGG 3 cut(s) 156, 234, 249
BssNI GRCGYC 1 cut(s) 227
BssT1I CCWWGG 1 cut(s) 249
Bst2UI CCWGG 1 cut(s) 157
Bst6I CTCTTC 1 cut(s) 140
BstACI GRCGYC 1 cut(s) 227
BstAPI GCANNNNNTGC 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 291
BstDEI CTNAG 3 cut(s) 14, 180, 258
BstDSI CCRYGG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 152
BstMWI GCNNNNNNNGC 5 cut(s) 158, 206, 215, 245, 269
BstNI CCWGG 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 289
BstSCI CCNGG 1 cut(s) 155
Bsu36I CCTNAGG 1 cut(s) 258
BsuRI GGCC 2 cut(s) 185, 200
BtgI CCRYGG 1 cut(s) 234
BtsCI GGATG 1 cut(s) 152
Cac8I GCNNGC 1 cut(s) 291
Cfr13I GGNCC 1 cut(s) 253
CseI GACGC 1 cut(s) 235
Csp6I GTAC 2 cut(s) 11, 318
CviAII CATG 3 cut(s) 40, 286, 301
CviJI RGCY 9 cut(s) 18, 55, 161, 185, 200, 239, 263, 272, 293
CviKI_1 RGCY 9 cut(s) 18, 55, 161, 185, 200, 239, 263, 272, 293
CviQI GTAC 2 cut(s) 11, 318
DdeI CTNAG 3 cut(s) 14, 180, 258
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
Eco130I CCWWGG 1 cut(s) 249
Eco24I GRGCYC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 253
Eco81I CCTNAGG 1 cut(s) 258
EcoO109I RGGNCCY 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 249
EcoT38I GRGCYC 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 249
FaeI CATG 3 cut(s) 43, 289, 304
FaiI YATR 3 cut(s) 41, 287, 302
FaqI GGGAC 2 cut(s) 83, 239
FatI CATG 3 cut(s) 39, 285, 300
FauI CCCGC 1 cut(s) 60
FokI GGATG 1 cut(s) 139
FriOI GRGCYC 1 cut(s) 163
HaeIII GGCC 2 cut(s) 185, 200
HgaI GACGC 1 cut(s) 235
Hin1I GRCGYC 1 cut(s) 227
Hin1II CATG 3 cut(s) 43, 289, 304
HphI GGTGA 2 cut(s) 22, 94
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 2 cut(s) 94, 109
HpyAV CCTTC 3 cut(s) 70, 79, 126
HpyF10VI GCNNNNNNNGC 5 cut(s) 158, 206, 215, 245, 269
HpyF3I CTNAG 3 cut(s) 14, 180, 258
Hsp92I GRCGYC 1 cut(s) 227
Hsp92II CATG 3 cut(s) 43, 289, 304
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 6 cut(s) 39, 142, 152, 169, 282, 303
LweI GCATC 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 28
MboII GAAGA 1 cut(s) 157
MfeI CAATTG 1 cut(s) 192
MhlI GDGCHC 1 cut(s) 163
MluCI AATT 1 cut(s) 192
MnlI CCTC 4 cut(s) 135, 165, 175, 190
MspR9I CCNGG 1 cut(s) 157
MunI CAATTG 1 cut(s) 192
Mva1269I GAATGC 1 cut(s) 181
MvaI CCWGG 1 cut(s) 157
MwoI GCNNNNNNNGC 5 cut(s) 158, 206, 215, 245, 269
NlaIII CATG 3 cut(s) 43, 289, 304
NlaIV GGNNCC 1 cut(s) 255
NmuCI GTSAC 1 cut(s) 28
NspI RCATGY 1 cut(s) 289
PctI GAATGC 1 cut(s) 181
PflFI GACNNNGTC 2 cut(s) 46, 229
PpuMI RGGWCCY 1 cut(s) 253
Psp5II RGGWCCY 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 255
PspPI GGNCC 1 cut(s) 253
PspPPI RGGWCCY 1 cut(s) 253
PsyI GACNNNGTC 2 cut(s) 46, 229
RsaI GTAC 2 cut(s) 12, 319
RsaNI GTAC 2 cut(s) 11, 318
Sau96I GGNCC 1 cut(s) 253
ScrFI CCNGG 1 cut(s) 157
SduI GDGCHC 1 cut(s) 163
SetI ASST 3 cut(s) 57, 90, 255
SfaNI GCATC 1 cut(s) 161
SinI GGWCC 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
Sse9I AATT 1 cut(s) 192
SsiI CCGC 2 cut(s) 67, 80
StyD4I CCNGG 1 cut(s) 155
StyI CCWWGG 1 cut(s) 249
TasI AATT 1 cut(s) 192
TatI WGTACW 1 cut(s) 317
TseFI GTSAC 1 cut(s) 28
Tsp45I GTSAC 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 289
TspGWI ACGGA 1 cut(s) 223
Tth111I GACNNNGTC 2 cut(s) 46, 229
VpaK11BI GGWCC 1 cut(s) 253
XceI RCATGY 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.