Rh1BG059400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0000949
Physical Location & Seq
Forward (+)
8732617 .. 8732874
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG059400.1

Sequence Viewer

Length: 258 bp
ATGTCCTCGCAACGGGCAACATCACAAGAGAGTCAAGAGCTTAACCCAAAGAATTTAGTTAAAAACAAGGAATATCTAGTTTATGGAGATGACTATTATCCAGGACCAATTACCCGCAATATGACTCAGAAGATAACACTTGGTACATCAAGGAGCATATACCACATATGGGGATGGAGATATGTGTCTTGGAAGGATAATCTTTTATATGAGGCGTCAATTCCAAAGGAAGGCTCCCCACCAGTCTTAATATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.84

Weight (kDa)

8.93

Isoelectric Point (pI)

54.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 115
AcsI RAATTY 1 cut(s) 52
AcyI GRCGYC 1 cut(s) 215
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 3 cut(s) 12, 169, 230
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
ApoI RAATTY 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 104
AvaII GGWCC 1 cut(s) 104
BccI CCATC 1 cut(s) 168
BciT130I CCWGG 1 cut(s) 102
BfaI CTAG 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 235
BmrFI CCNGG 1 cut(s) 102
BsaHI GRCGYC 1 cut(s) 215
Bsc4I CCNNNNNNNGG 3 cut(s) 12, 169, 230
Bse1I ACTGG 1 cut(s) 242
BseBI CCWGG 1 cut(s) 102
BseGI GGATG 1 cut(s) 179
BseLI CCNNNNNNNGG 3 cut(s) 12, 169, 230
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 242
BslI CCNNNNNNNGG 3 cut(s) 12, 169, 230
BspACI CCGC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 235
BsrI ACTGG 1 cut(s) 242
BssNI GRCGYC 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 102
BstACI GRCGYC 1 cut(s) 215
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 179
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BtsCI GGATG 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 104
CseI GACGC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 144
CviJI RGCY 2 cut(s) 40, 234
CviKI_1 RGCY 2 cut(s) 40, 234
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 100
FaiI YATR 9 cut(s) 84, 122, 158, 160, 167, 169, 183, 208, 210
FauI CCCGC 1 cut(s) 122
FauNDI CATATG 1 cut(s) 167
FokI GGATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 77
HgaI GACGC 1 cut(s) 204
Hin1I GRCGYC 1 cut(s) 215
HinfI GANTC 2 cut(s) 31, 124
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 35
HpyAV CCTTC 2 cut(s) 187, 224
HpyF3I CTNAG 1 cut(s) 126
Hsp92I GRCGYC 1 cut(s) 215
LmnI GCTCC 2 cut(s) 153, 239
LpnPI CCDG 2 cut(s) 87, 114
MaeI CTAG 1 cut(s) 77
MboII GAAGA 1 cut(s) 142
MluCI AATT 3 cut(s) 52, 108, 219
MlyI GAGTC 2 cut(s) 40, 118
MnlI CCTC 2 cut(s) 16, 205
MseI TTAA 4 cut(s) 42, 60, 248, 256
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
NdeI CATATG 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 235
PfoI TCCNGGA 1 cut(s) 100
PleI GAGTC 2 cut(s) 39, 118
PpsI GAGTC 2 cut(s) 39, 118
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 235
PspPI GGNCC 1 cut(s) 104
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 4 cut(s) 42, 60, 248, 256
Sau96I GGNCC 1 cut(s) 104
SchI GAGTC 2 cut(s) 40, 118
ScrFI CCNGG 1 cut(s) 102
SetI ASST 1 cut(s) 42
SinI GGWCC 1 cut(s) 104
Sse9I AATT 3 cut(s) 52, 108, 219
SsiI CCGC 1 cut(s) 115
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 100
TasI AATT 3 cut(s) 52, 108, 219
Tru1I TTAA 4 cut(s) 42, 60, 248, 256
Tru9I TTAA 4 cut(s) 42, 60, 248, 256
VpaK11BI GGWCC 1 cut(s) 104
XapI RAATTY 1 cut(s) 52
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.