Rmu_sc0018308.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018308.1
OG0000949
Physical Location & Seq
Forward (+)
1 .. 711
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018308.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
gaagaggaggccaagaggcgcaatgaaatagaagcagtagcagtcaaaaaattggaagagaaggaggctgaagtagctgtattggtagcacagctagccttaatggccaataacaaggacaagggcaaagaaatattccagtattcagaacgaaaacatgtggaatgtggaggttcttcaggcggctcaaacacattctctccggacgacatcaagatagttttagcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.35

Weight (kDa)

5.17

Isoelectric Point (pI)

61.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 202
AciI CCGC 1 cut(s) 183
AcoI YGGCCR 1 cut(s) 105
AcuI CTGAAG 2 cut(s) 90, 162
AflIII ACRYGT 1 cut(s) 157
AluBI AGCT 2 cut(s) 77, 94
AluI AGCT 2 cut(s) 77, 94
Aor13HI TCCGGA 1 cut(s) 202
AoxI GGCC 2 cut(s) 9, 105
AspLEI GCGC 1 cut(s) 21
AsuNHI GCTAGC 1 cut(s) 94
BalI TGGCCA 1 cut(s) 107
BfaI CTAG 2 cut(s) 95, 229
BglI GCCNNNNNGGC 1 cut(s) 104
BisI GCNGC 1 cut(s) 184
BlsI GCNGC 1 cut(s) 185
BmtI GCTAGC 1 cut(s) 98
BsaWI WCCGGW 1 cut(s) 202
BsaXI ACNNNNNCTCC 2 cut(s) 184, 214
Bse1I ACTGG 1 cut(s) 139
Bse3DI GCAATG 1 cut(s) 28
BseAI TCCGGA 1 cut(s) 202
BseMI GCAATG 1 cut(s) 28
BseNI ACTGG 1 cut(s) 139
BseRI GAGGAG 1 cut(s) 20
BshFI GGCC 2 cut(s) 11, 107
BsiSI CCGG 1 cut(s) 203
BsnI GGCC 2 cut(s) 11, 107
Bsp13I TCCGGA 1 cut(s) 202
BspACI CCGC 1 cut(s) 183
BspANI GGCC 2 cut(s) 11, 107
BspEI TCCGGA 1 cut(s) 202
BspOI GCTAGC 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 28
BsrI ACTGG 1 cut(s) 139
Bst6I CTCTTC 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 96
BstHHI GCGC 1 cut(s) 21
BstMWI GCNNNNNNNGC 3 cut(s) 74, 95, 104
BstNSI RCATGY 1 cut(s) 161
BsuRI GGCC 2 cut(s) 11, 107
Cac8I GCNNGC 1 cut(s) 96
CfoI GCGC 1 cut(s) 21
CviAII CATG 1 cut(s) 158
CviJI RGCY 8 cut(s) 11, 68, 77, 94, 98, 107, 186, 227
CviKI_1 RGCY 8 cut(s) 11, 68, 77, 94, 98, 107, 186, 227
EaeI YGGCCR 1 cut(s) 105
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco57I CTGAAG 2 cut(s) 90, 162
FaeI CATG 1 cut(s) 161
FaiI YATR 1 cut(s) 159
FatI CATG 1 cut(s) 157
Fnu4HI GCNGC 1 cut(s) 184
Fsp4HI GCNGC 1 cut(s) 184
FspBI CTAG 2 cut(s) 95, 229
GlaI GCGC 1 cut(s) 20
GluI GCNGC 1 cut(s) 184
HaeIII GGCC 2 cut(s) 11, 107
HapII CCGG 1 cut(s) 203
HhaI GCGC 1 cut(s) 21
Hin1II CATG 1 cut(s) 161
Hin6I GCGC 1 cut(s) 19
HinP1I GCGC 1 cut(s) 19
HpaII CCGG 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 203, 214
HpyAV CCTTC 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 3 cut(s) 74, 95, 104
Hsp92II CATG 1 cut(s) 161
HspAI GCGC 1 cut(s) 19
Kpn2I TCCGGA 1 cut(s) 202
LpnPI CCDG 3 cut(s) 152, 165, 216
MaeI CTAG 2 cut(s) 95, 229
MboII GAAGA 3 cut(s) 14, 68, 168
MlsI TGGCCA 1 cut(s) 107
MluCI AATT 1 cut(s) 50
MluNI TGGCCA 1 cut(s) 107
MnlI CCTC 3 cut(s) 9, 58, 164
Mox20I TGGCCA 1 cut(s) 107
MroI TCCGGA 1 cut(s) 202
MscI TGGCCA 1 cut(s) 107
MseI TTAA 1 cut(s) 101
Msp20I TGGCCA 1 cut(s) 107
MspI CCGG 1 cut(s) 203
MwoI GCNNNNNNNGC 3 cut(s) 74, 95, 104
NheI GCTAGC 1 cut(s) 94
NlaIII CATG 1 cut(s) 161
NspI RCATGY 1 cut(s) 161
PciI ACATGT 1 cut(s) 157
PkrI GCNGC 1 cut(s) 185
PscI ACATGT 1 cut(s) 157
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 1 cut(s) 184
SetI ASST 3 cut(s) 79, 96, 175
SgeI CNNG 9 cut(s) 25, 107, 127, 133, 151, 170, 192, 215, 226
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 183
SspI AATATT 1 cut(s) 135
SspMI CTAG 2 cut(s) 95, 229
TasI AATT 1 cut(s) 50
TauI GCSGC 1 cut(s) 186
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 39
XceI RCATGY 1 cut(s) 161
XspI CTAG 2 cut(s) 95, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.