Rroxscaffold_3G00254520

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000949
Physical Location & Seq
Reverse (-)
48765632 .. 48767806
2175 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00254520.1

Sequence Viewer

Length: 309 bp
ATGCATAAGCTGATCATGGGTGTCCAGATCAGATGTCTAGGTGTGCAGATAAGATACTCTGCCCAGAAAATTGAATCTCCGCCAGGGATTAGAGCTTCGCCTCCTTACAGCTCGGCTAAGAGGATTGAAGCGGTGGCCAGCGGTGGTGATGTTCAGCGGAGAACCTTTTGGTCAGCTGAGCTTGTGTTTTTTTTTTGGTTGGTCAGCGGTGCCTTTACGATGTCGGAGCTTAGCGGAGGAAATTTACCGTTGATGATTAGGTCGTGCAATGGAGGTTGGCAGAGCGGAGCGGAGGTTGCTGACCGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.16

Weight (kDa)

9.58

Isoelectric Point (pI)

71.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 209
AccBSI CCGCTC 2 cut(s) 285, 290
AciI CCGC 9 cut(s) 80, 131, 141, 157, 207, 234, 285, 290, 304
AcoI YGGCCR 1 cut(s) 135
AcsI RAATTY 1 cut(s) 241
AgsI TTSAA 2 cut(s) 74, 128
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 6 cut(s) 10, 95, 111, 176, 181, 229
AluI AGCT 6 cut(s) 10, 95, 111, 176, 181, 229
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 158
BalI TGGCCA 1 cut(s) 137
BanI GGYRCC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 84
BclI TGATCA 1 cut(s) 12
BfaI CTAG 1 cut(s) 38
BlpI GCTNAGC 2 cut(s) 177, 230
Bme1390I CCNGG 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 211
BmrFI CCNGG 1 cut(s) 84
Bpu1102I GCTNAGC 2 cut(s) 177, 230
BsaJI CCNNGG 1 cut(s) 83
BsaXI ACNNNNNCTCC 2 cut(s) 279, 309
Bse3DI GCAATG 1 cut(s) 274
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 83
BseMI GCAATG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 168
BsgI GTGCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 137
BshNI GGYRCC 1 cut(s) 209
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 2 cut(s) 12, 27
Bsp1720I GCTNAGC 2 cut(s) 177, 230
BspACI CCGC 9 cut(s) 80, 131, 141, 157, 207, 234, 285, 290, 304
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 169
BspLI GGNNCC 1 cut(s) 211
BspT107I GGYRCC 1 cut(s) 209
BsrBI CCGCTC 2 cut(s) 285, 290
BsrDI GCAATG 1 cut(s) 274
BssECI CCNNGG 1 cut(s) 83
BssMI GATC 2 cut(s) 12, 27
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 249
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 3 cut(s) 117, 177, 230
BstKTI GATC 2 cut(s) 15, 30
BstMBI GATC 2 cut(s) 12, 27
BstMWI GCNNNNNNNGC 1 cut(s) 296
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BsuRI GGCC 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 139
CviAII CATG 1 cut(s) 16
CviJI RGCY 8 cut(s) 10, 95, 111, 116, 137, 176, 181, 229
CviKI_1 RGCY 8 cut(s) 10, 95, 111, 116, 137, 176, 181, 229
DdeI CTNAG 3 cut(s) 117, 177, 230
DpnI GATC 2 cut(s) 14, 29
DpnII GATC 2 cut(s) 12, 27
EaeI YGGCCR 1 cut(s) 135
EciI GGCGGA 1 cut(s) 69
EcoRII CCWGG 1 cut(s) 82
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 19
FaiI YATR 2 cut(s) 6, 17
FatI CATG 1 cut(s) 15
FbaI TGATCA 1 cut(s) 12
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 1 cut(s) 19
HinfI GANTC 1 cut(s) 74
HphI GGTGA 1 cut(s) 158
Hpy188I TCNGA 2 cut(s) 32, 226
Hpy188III TCNNGA 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 249
HpyCH4V TGCA 3 cut(s) 4, 46, 267
HpyF10VI GCNNNNNNNGC 1 cut(s) 296
HpyF3I CTNAG 3 cut(s) 117, 177, 230
Hsp92II CATG 1 cut(s) 19
Ksp22I TGATCA 1 cut(s) 12
Kzo9I GATC 2 cut(s) 12, 27
LmnI GCTCC 2 cut(s) 226, 287
LpnPI CCDG 5 cut(s) 38, 69, 77, 96, 151
MaeI CTAG 1 cut(s) 38
MalI GATC 2 cut(s) 14, 29
MbiI CCGCTC 2 cut(s) 285, 290
MboI GATC 2 cut(s) 12, 27
MlsI TGGCCA 1 cut(s) 137
MluCI AATT 2 cut(s) 69, 241
MluNI TGGCCA 1 cut(s) 137
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 5 cut(s) 111, 114, 230, 266, 286
Mox20I TGGCCA 1 cut(s) 137
Mph1103I ATGCAT 1 cut(s) 6
MscI TGGCCA 1 cut(s) 137
Msp20I TGGCCA 1 cut(s) 137
MspA1I CMGCKG 5 cut(s) 141, 157, 176, 207, 306
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 296
NdeII GATC 2 cut(s) 12, 27
NlaIII CATG 1 cut(s) 19
NlaIV GGNNCC 1 cut(s) 211
NmeAIII GCCGAG 1 cut(s) 92
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 211
PvuII CAGCTG 1 cut(s) 176
Sau3AI GATC 2 cut(s) 12, 27
ScrFI CCNGG 1 cut(s) 84
Sse9I AATT 2 cut(s) 69, 241
SsiI CCGC 9 cut(s) 80, 131, 141, 157, 207, 234, 285, 290, 304
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 82
TaaI ACNGT 1 cut(s) 249
TasI AATT 2 cut(s) 69, 241
TfiI GAWTC 1 cut(s) 74
XapI RAATTY 1 cut(s) 241
XspI CTAG 1 cut(s) 38
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.