RLG00000004166

RING-H2 finger protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0000675
Physical Location & Seq
Reverse (-)
56815568 .. 56816596
1029 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000004166

Sequence Viewer

Length: 393 bp
ATGATTCCAATCGAACCAAGAAACCATAAAGACCCACCAAATCCATTTGATTGGAAGAACCTTAACTTCCGTGTTCAGTTGACATGGGACGACATTGGGTGTCAGAATTGTGAAGCATCTGGTAAAATTTGCCAACTTGATCGGTCTGGGAGAGTCGAGTGCGGTTCAACTATACTAATGTGGAGTACTAGTAATGTAATGATCGATATGAAATTTTTCAGCAATATTTTCAAGGCTTCCAAGAGCTGCAAGGATTACCAGTATGATATTGATTATAAGCCCTCTAGTTTCAGTACTACTGGTGGTCTTGATGGAGCGATCATTGAATCATATTCAAAGACTCAGCTTGGTGAGAATCAAGAATTGCCCAACTCCAGTACAACACTTGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GUB_WAK_bind zf-RING_2

Protein Analysis

131

Amino Acids

14.66

Weight (kDa)

5.06

Isoelectric Point (pI)

38.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 276
AciI CCGC 1 cut(s) 162
AcsI RAATTY 2 cut(s) 126, 212
AfaI GTAC 3 cut(s) 187, 295, 379
AgsI TTSAA 4 cut(s) 168, 232, 326, 336
AhlI ACTAGT 1 cut(s) 188
AluBI AGCT 2 cut(s) 246, 346
AluI AGCT 2 cut(s) 246, 346
ApeKI GCWGC 1 cut(s) 246
ApoI RAATTY 2 cut(s) 126, 212
Asp700I GAANNNNTTC 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 362
BbvI GCAGC 1 cut(s) 233
BccI CCATC 1 cut(s) 305
BcuI ACTAGT 1 cut(s) 188
BfaI CTAG 2 cut(s) 189, 285
BisI GCNGC 1 cut(s) 247
BlsI GCNGC 1 cut(s) 248
BmcAI AGTACT 2 cut(s) 187, 295
BmsI GCATC 1 cut(s) 125
BpmI CTGGAG 1 cut(s) 358
Bsa29I ATCGAT 1 cut(s) 204
BsaBI GATNNNNATC 1 cut(s) 8
BsaXI ACNNNNNCTCC 2 cut(s) 175, 205
Bse1I ACTGG 3 cut(s) 259, 304, 375
Bse8I GATNNNNATC 1 cut(s) 8
BseCI ATCGAT 1 cut(s) 204
BseJI GATNNNNATC 1 cut(s) 8
BseMII CTCAG 1 cut(s) 356
BseNI ACTGG 3 cut(s) 259, 304, 375
BseXI GCAGC 1 cut(s) 233
BshVI ATCGAT 1 cut(s) 204
BslFI GGGAC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 101
Bsp143I GATC 3 cut(s) 139, 201, 318
BspACI CCGC 1 cut(s) 162
BspCNI CTCAG 1 cut(s) 355
BspDI ATCGAT 1 cut(s) 204
BsrI ACTGG 3 cut(s) 259, 304, 375
BssMI GATC 3 cut(s) 139, 201, 318
BstDEI CTNAG 1 cut(s) 342
BstKTI GATC 3 cut(s) 142, 204, 321
BstMBI GATC 3 cut(s) 139, 201, 318
BstV1I GCAGC 1 cut(s) 233
BstXI CCANNNNNNTGG 1 cut(s) 51
Bsu15I ATCGAT 1 cut(s) 204
BsuTUI ATCGAT 1 cut(s) 204
ClaI ATCGAT 1 cut(s) 204
Csp6I GTAC 3 cut(s) 186, 294, 378
CviAII CATG 1 cut(s) 84
CviJI RGCY 4 cut(s) 236, 246, 280, 346
CviKI_1 RGCY 4 cut(s) 236, 246, 280, 346
CviQI GTAC 3 cut(s) 186, 294, 378
DdeI CTNAG 1 cut(s) 342
DpnI GATC 3 cut(s) 141, 203, 320
DpnII GATC 3 cut(s) 139, 201, 318
FaeI CATG 1 cut(s) 87
FaiI YATR 7 cut(s) 27, 85, 173, 209, 264, 276, 331
FaqI GGGAC 1 cut(s) 101
FatI CATG 1 cut(s) 83
Fnu4HI GCNGC 1 cut(s) 247
Fsp4HI GCNGC 1 cut(s) 247
FspBI CTAG 2 cut(s) 189, 285
GluI GCNGC 1 cut(s) 247
GsuI CTGGAG 1 cut(s) 358
Hin1II CATG 1 cut(s) 87
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 5 cut(s) 4, 153, 326, 340, 355
HphI GGTGA 1 cut(s) 362
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 2 cut(s) 308, 359
Hpy8I GTNNAC 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 249
HpyF3I CTNAG 1 cut(s) 342
Hsp92II CATG 1 cut(s) 87
Kzo9I GATC 3 cut(s) 139, 201, 318
LmnI GCTCC 1 cut(s) 314
LpnPI CCDG 5 cut(s) 105, 132, 272, 285, 388
Lsp1109I GCAGC 1 cut(s) 233
LweI GCATC 1 cut(s) 125
MaeI CTAG 2 cut(s) 189, 285
MalI GATC 3 cut(s) 141, 203, 320
MboI GATC 3 cut(s) 139, 201, 318
MboII GAAGA 1 cut(s) 67
MluCI AATT 4 cut(s) 106, 126, 212, 362
MlyI GAGTC 2 cut(s) 162, 334
MnlI CCTC 1 cut(s) 292
MroXI GAANNNNTTC 1 cut(s) 215
MseI TTAA 1 cut(s) 63
NdeII GATC 3 cut(s) 139, 201, 318
NlaIII CATG 1 cut(s) 87
PdmI GAANNNNTTC 1 cut(s) 215
PfeI GAWTC 3 cut(s) 4, 326, 355
PkrI GCNGC 1 cut(s) 248
PleI GAGTC 2 cut(s) 161, 334
PpsI GAGTC 2 cut(s) 161, 334
PsiI TTATAA 1 cut(s) 276
RsaI GTAC 3 cut(s) 187, 295, 379
RsaNI GTAC 3 cut(s) 186, 294, 378
SaqAI TTAA 1 cut(s) 63
SatI GCNGC 1 cut(s) 247
Sau3AI GATC 3 cut(s) 139, 201, 318
ScaI AGTACT 2 cut(s) 187, 295
SchI GAGTC 2 cut(s) 162, 334
SetI ASST 3 cut(s) 63, 248, 348
SfaNI GCATC 1 cut(s) 125
SpeI ACTAGT 1 cut(s) 188
Sse9I AATT 4 cut(s) 106, 126, 212, 362
SsiI CCGC 1 cut(s) 162
SspI AATATT 1 cut(s) 226
SspMI CTAG 2 cut(s) 189, 285
TaqI TCGA 3 cut(s) 12, 156, 204
TaqII GACCGA 1 cut(s) 132
TasI AATT 4 cut(s) 106, 126, 212, 362
TatI WGTACW 3 cut(s) 185, 293, 377
TfiI GAWTC 3 cut(s) 4, 326, 355
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TseI GCWGC 1 cut(s) 246
TspDTI ATGAA 1 cut(s) 224
TspGWI ACGGA 1 cut(s) 59
XapI RAATTY 2 cut(s) 126, 212
XmnI GAANNNNTTC 1 cut(s) 215
XspI CTAG 2 cut(s) 189, 285
ZrmI AGTACT 2 cut(s) 187, 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.