Rmu_co8197174.1_g000001

RING-H2 finger protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8197174.1
OG0000675
Physical Location & Seq
Forward (+)
183 .. 680
498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8197174.1_g000001.1.cds

Sequence Viewer

Length: 498 bp
atgaaactgaatattgtcgtttcagtacaccagagcaaatcaggcgtctctttccgtctctcaactgcaacatacataggcgggggaatgcttgtgctattgttcatctgcgtgtttgcaatatgttgttttgctaaaccacctagcgatgtacccaccacagaatggttggcggtaacaaatcatcaacgaactccttcggcattggcgctcaatagtgtgactaccgaagcatatcccaagactcaacttggtgatgagagtttggaactgcctaaccccaatgaaaaaacttgtgcaatatgtttgtgcgagtaccagcgaaaggaaacaataaagactataccacgatgcaaccattactttcatgttacttgcatagatgagtggtttaaaacgaatgtgacgtgcccactttgccgaaacccaccgaacaatgaggggcttggtttccctggacaacctttgcaagatatgagtgttggtttctctctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GUB_WAK_bind zf-RING_2

Protein Analysis

165

Amino Acids

18.26

Weight (kDa)

6.86

Isoelectric Point (pI)

31.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 165
AciI CCGC 2 cut(s) 81, 173
AcyI GRCGYC 1 cut(s) 45
AfaI GTAC 3 cut(s) 27, 153, 317
AfiI CCNNNNNNNGG 2 cut(s) 165, 325
AjiI CACGTC 1 cut(s) 408
AjnI CCWGG 1 cut(s) 454
Alw26I GTCTC 2 cut(s) 52, 62
ArsI GACNNNNNNTTYG 2 cut(s) 30, 62
Asp700I GAANNNNTTC 1 cut(s) 196
AspLEI GCGC 1 cut(s) 211
AsuHPI GGTGA 1 cut(s) 266
BaeGI GKGCMC 1 cut(s) 413
BciT130I CCWGG 1 cut(s) 456
BcoDI GTCTC 2 cut(s) 52, 62
BfaI CTAG 1 cut(s) 144
BfmI CTRYAG 1 cut(s) 494
BfoI RGCGCY 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 456
BmgBI CACGTC 1 cut(s) 408
BmrFI CCNGG 1 cut(s) 456
BmsI GCATC 1 cut(s) 341
BsaHI GRCGYC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 454
Bsc4I CCNNNNNNNGG 2 cut(s) 165, 325
BseBI CCWGG 1 cut(s) 456
BseDI CCNNGG 1 cut(s) 454
BseLI CCNNNNNNNGG 2 cut(s) 165, 325
BseSI GKGCMC 1 cut(s) 413
BslI CCNNNNNNNGG 2 cut(s) 165, 325
BsmAI GTCTC 2 cut(s) 52, 62
BsmBI CGTCTC 2 cut(s) 52, 62
BsmI GAATGC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 413
BspACI CCGC 2 cut(s) 81, 173
BssECI CCNNGG 1 cut(s) 454
BssNI GRCGYC 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 456
BstACI GRCGYC 1 cut(s) 45
BstH2I RGCGCY 1 cut(s) 212
BstHHI GCGC 1 cut(s) 211
BstMAI GTCTC 2 cut(s) 52, 62
BstMWI GCNNNNNNNGC 2 cut(s) 42, 417
BstNI CCWGG 1 cut(s) 456
BstSCI CCNGG 1 cut(s) 454
BstSFI CTRYAG 1 cut(s) 494
BstSLI GKGCMC 1 cut(s) 413
BtgZI GCGATG 1 cut(s) 162
BtrI CACGTC 1 cut(s) 408
CfoI GCGC 1 cut(s) 211
CseI GACGC 1 cut(s) 34
Csp6I GTAC 3 cut(s) 26, 152, 316
CviAII CATG 1 cut(s) 368
CviJI RGCY 1 cut(s) 445
CviKI_1 RGCY 1 cut(s) 445
CviQI GTAC 3 cut(s) 26, 152, 316
DraI TTTAAA 1 cut(s) 394
EcoRII CCWGG 1 cut(s) 454
Esp3I CGTCTC 2 cut(s) 52, 62
FaeI CATG 1 cut(s) 371
FaiI YATR 9 cut(s) 73, 77, 124, 235, 304, 344, 369, 380, 476
FatI CATG 1 cut(s) 367
FauI CCCGC 1 cut(s) 74
FspBI CTAG 1 cut(s) 144
GlaI GCGC 1 cut(s) 210
HaeII RGCGCY 1 cut(s) 212
HgaI GACGC 1 cut(s) 34
HhaI GCGC 1 cut(s) 211
Hin1I GRCGYC 1 cut(s) 45
Hin1II CATG 1 cut(s) 371
Hin6I GCGC 1 cut(s) 209
HinP1I GCGC 1 cut(s) 209
HinfI GANTC 1 cut(s) 244
HphI GGTGA 1 cut(s) 266
Hpy166II GTNNAC 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 407
HpyCH4V TGCA 6 cut(s) 68, 119, 299, 354, 378, 469
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 417
HpySE526I ACGT 1 cut(s) 407
Hsp92I GRCGYC 1 cut(s) 45
Hsp92II CATG 1 cut(s) 371
HspAI GCGC 1 cut(s) 209
LpnPI CCDG 5 cut(s) 27, 44, 332, 441, 468
LweI GCATC 1 cut(s) 341
MaeI CTAG 1 cut(s) 144
MaeII ACGT 1 cut(s) 407
MaeIII GTNAC 4 cut(s) 175, 220, 370, 403
MhlI GDGCHC 1 cut(s) 413
MlyI GAGTC 1 cut(s) 238
MnlI CCTC 1 cut(s) 433
MroXI GAANNNNTTC 1 cut(s) 196
MseI TTAA 1 cut(s) 393
MslI CAYNNNNRTG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 456
Mva1269I GAATGC 1 cut(s) 93
MvaI CCWGG 1 cut(s) 456
MwoI GCNNNNNNNGC 2 cut(s) 42, 417
NlaIII CATG 1 cut(s) 371
NmuCI GTSAC 2 cut(s) 220, 403
PcsI WCGNNNNNNNCGW 1 cut(s) 404
PctI GAATGC 1 cut(s) 93
PdmI GAANNNNTTC 1 cut(s) 196
PflMI CCANNNNNTGG 1 cut(s) 165
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 454
PspGI CCWGG 1 cut(s) 454
RsaI GTAC 3 cut(s) 27, 153, 317
RsaNI GTAC 3 cut(s) 26, 152, 316
RseI CAYNNNNRTG 1 cut(s) 110
SaqAI TTAA 1 cut(s) 393
SchI GAGTC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 456
SduI GDGCHC 1 cut(s) 413
SetI ASST 3 cut(s) 145, 410, 466
SfaNI GCATC 1 cut(s) 341
SfcI CTRYAG 1 cut(s) 494
SmiMI CAYNNNNRTG 1 cut(s) 110
SsiI CCGC 2 cut(s) 81, 173
SspI AATATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 144
StyD4I CCNGG 1 cut(s) 454
TaiI ACGT 1 cut(s) 410
TatI WGTACW 1 cut(s) 25
Tru1I TTAA 1 cut(s) 393
Tru9I TTAA 1 cut(s) 393
TseFI GTSAC 2 cut(s) 220, 403
Tsp45I GTSAC 2 cut(s) 220, 403
TspDTI ATGAA 4 cut(s) 17, 94, 300, 356
TspGWI ACGGA 1 cut(s) 44
Van91I CCANNNNNTGG 1 cut(s) 165
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XmnI GAANNNNTTC 1 cut(s) 196
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.