Rmu_sc0000751.1_g000002

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000751.1
Physical Location & Seq
Forward (+)
1877 .. 2380
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000751.1_g000002.1.cds

Sequence Viewer

Length: 504 bp
atgatgtcacagcagttgacagagaagtctgatgtgtactcatttggtgtagttcttcttgaggtgttatgtggaagacctgctattgatataacgcttccaagagagaaagtgaacttagctgaatgggttgtgctgtgcaagaaagaagggttgctagaagaggtcattgacgtttcattgaaggatcatattgatcctagctcactgagacattttattgagactgcagagaagtgtttgcaacacgattcttctgataggcccactatggctgaggtgctgtgggatttggactatacattgaagcttcatcaaactgcgaggcttggagaagcccatgaggacagcactaccagtgcttcatcagcttttttactaccaaatattcggcattttgcttcacttgattcgacagttaacagagctgatatgagggacgatgagatggagtccacagaaagcgaaattttctcccaactgagaatcggcgaggccagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

167

Amino Acids

18.91

Weight (kDa)

4.73

Isoelectric Point (pI)

48.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000413)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G23200
fragaria_vesca FvH4_1g16860 FvH4_1g16861
malus_domestica MD02G1018900.v1.1 MD15G1289500.v1.1 MD15G1289600.v1.1 MD15G1289700.v1.1
prunus_persica Prupe.6G227800_v2.0.a1 Prupe.6G228000_v2.0.a1 Prupe.6G228100_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228300_v2.0.a1
pyrus_communis pycom02g01680 pycom02g01690 pycom15g25310 pycom15g25330 pycom15g25340
rosa_chinensis RchiOBHm_Chr1g0324321 RchiOBHm_Chr1g0324331 RchiOBHm_Chr1g0324341 RchiOBHm_Chr1g0324401 RchiOBHm_Chr1g0324441 RchiOBHm_Chr2g0106751 RchiOBHm_Chr2g0106761 RchiOBHm_Chr2g0106771 RchiOBHm_Chr2g0106781 RchiOBHm_Chr2g0106801 RchiOBHm_Chr2g0106811 RchiOBHm_Chr2g0106821
rosa_laevigata RLG00000017539 RLG00000017540 RLG00000017541 RLG00000030200 RLG00000030201
rosa_multiflora Rmu_sc0000751.1_g000001 Rmu_sc0000751.1_g000002 Rmu_sc0000751.1_g000003 Rmu_sc0000751.1_g000005 Rmu_sc0000751.1_g000007 Rmu_sc0000751.1_g000008 Rmu_sc0000751.1_g000018 Rmu_sc0000751.1_g000019 Rmu_sc0000751.1_g000026 Rmu_sc0000751.1_g000027 Rmu_sc0000751.1_g000028 Rmu_sc0000751.1_g000029 Rmu_sc0003410.1_g000012 Rmu_sc0004000.1_g000023 Rmu_sc0004000.1_g000024 Rmu_sc0004082.1_g000015 Rmu_sc0004082.1_g000017 Rmu_sc0026507.1_g000001 Rmu_sc0031196.1_g000001 Rmu_sc0039591.1_g000001
rosa_roxburghii Rroxscaffold_159G00432710 Rroxscaffold_159G00432780 Rroxscaffold_159G00432840 Rroxscaffold_159G00433010 Rroxscaffold_2G00098070 Rroxscaffold_2G00136770 Rroxscaffold_4G00325540 Rroxscaffold_4G00325630 Rroxscaffold_4G00325680
rosa_rugosa Rorug01G0045700 Rorug02G0138500 Rorug02G0138600 Rorug02G0138700 Rorug02G0138800 Rorug02G0138900
rosa_samantha Rh1AG061400 Rh1BG052300 Rh1CG063400 Rh1CG063700 Rh1DG067800 Rh2AG189400 Rh2AG189800 Rh2AG190000 Rh2AG190100 Rh2BG201100 Rh2BG201300 Rh2CG194500 Rh2CG194600 Rh2CG194700 Rh2DG195700 Rh2DG195900 Rh2DG196300 Rh2DG196400 Rh2DG196500 Rh2DG196600
rosa_wichuraiana Rw1G004230 Rw1G005210 Rw2G014900 Rw2G014910 Rw2G014930 Rw2G014940 Rw2G014950 Rw2G014960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 25
Acc36I ACCTGC 1 cut(s) 88
AclWI GGATC 2 cut(s) 191, 195
AcsI RAATTY 1 cut(s) 468
AfaI GTAC 1 cut(s) 38
AgsI TTSAA 2 cut(s) 184, 307
AluBI AGCT 5 cut(s) 122, 204, 310, 371, 428
AluI AGCT 5 cut(s) 122, 204, 310, 371, 428
Alw26I GTCTC 2 cut(s) 205, 218
AlwI GGATC 2 cut(s) 191, 195
AoxI GGCC 2 cut(s) 263, 495
ApoI RAATTY 1 cut(s) 468
AspS9I GGNCC 1 cut(s) 264
BbsI GAAGAC 1 cut(s) 82
BbvCI CCTCAGC 1 cut(s) 276
BccI CCATC 1 cut(s) 442
BcoDI GTCTC 2 cut(s) 205, 218
BfaI CTAG 2 cut(s) 158, 201
BfmI CTRYAG 1 cut(s) 228
BfuAI ACCTGC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 264
BpiI GAAGAC 1 cut(s) 82
Bpu10I CCTNAGC 1 cut(s) 276
BpuEI CTTGAG 1 cut(s) 80
Bse1I ACTGG 1 cut(s) 357
BseMII CTCAG 3 cut(s) 200, 267, 473
BseNI ACTGG 1 cut(s) 357
BshFI GGCC 2 cut(s) 265, 497
BslFI GGGAC 1 cut(s) 452
BsmAI GTCTC 2 cut(s) 205, 218
BsmFI GGGAC 1 cut(s) 452
BsnI GGCC 2 cut(s) 265, 497
Bsp143I GATC 2 cut(s) 187, 196
BspANI GGCC 2 cut(s) 265, 497
BspCNI CTCAG 3 cut(s) 201, 268, 474
BspMAI CTGCAG 1 cut(s) 232
BspMI ACCTGC 1 cut(s) 88
BspPI GGATC 2 cut(s) 191, 195
BsrI ACTGG 1 cut(s) 357
BssMI GATC 2 cut(s) 187, 196
Bst4CI ACNGT 1 cut(s) 418
Bst6I CTCTTC 1 cut(s) 156
BstDEI CTNAG 4 cut(s) 118, 209, 276, 482
BstKTI GATC 2 cut(s) 190, 199
BstMAI GTCTC 2 cut(s) 205, 218
BstMBI GATC 2 cut(s) 187, 196
BstMWI GCNNNNNNNGC 1 cut(s) 368
BstSFI CTRYAG 1 cut(s) 228
BstV2I GAAGAC 1 cut(s) 82
BsuRI GGCC 2 cut(s) 265, 497
BtsIMutI CAGTG 2 cut(s) 206, 364
BveI ACCTGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 264
Csp6I GTAC 1 cut(s) 37
CviAII CATG 1 cut(s) 341
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 4 cut(s) 118, 209, 276, 482
DpnI GATC 2 cut(s) 189, 198
DpnII GATC 2 cut(s) 187, 196
DrdI GACNNNNNNGTC 1 cut(s) 25
DseDI GACNNNNNNGTC 1 cut(s) 25
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
FaeI CATG 1 cut(s) 344
FaiI YATR 7 cut(s) 70, 92, 192, 272, 300, 342, 434
FaqI GGGAC 1 cut(s) 452
FatI CATG 1 cut(s) 340
FspBI CTAG 2 cut(s) 158, 201
HaeIII GGCC 2 cut(s) 265, 497
Hin1II CATG 1 cut(s) 344
HincII GTYRAC 2 cut(s) 18, 421
HindII GTYRAC 2 cut(s) 18, 421
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 4 cut(s) 251, 410, 452, 486
HpaI GTTAAC 1 cut(s) 421
Hpy166II GTNNAC 5 cut(s) 18, 37, 115, 421, 456
Hpy188I TCNGA 2 cut(s) 31, 259
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 5 cut(s) 18, 37, 115, 421, 456
HpyAV CCTTC 2 cut(s) 143, 178
HpyCH4III ACNGT 1 cut(s) 418
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 3 cut(s) 141, 230, 244
HpyF10VI GCNNNNNNNGC 1 cut(s) 368
HpyF3I CTNAG 4 cut(s) 118, 209, 276, 482
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 1 cut(s) 344
KspAI GTTAAC 1 cut(s) 421
Kzo9I GATC 2 cut(s) 187, 196
LpnPI CCDG 2 cut(s) 93, 370
MaeI CTAG 2 cut(s) 158, 201
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 6
MalI GATC 2 cut(s) 189, 198
MboI GATC 2 cut(s) 187, 196
MboII GAAGA 4 cut(s) 47, 87, 173, 246
MluCI AATT 1 cut(s) 468
MlyI GAGTC 1 cut(s) 461
MnlI CCTC 7 cut(s) 55, 157, 271, 318, 337, 429, 487
MseI TTAA 1 cut(s) 420
MwoI GCNNNNNNNGC 1 cut(s) 368
NdeII GATC 2 cut(s) 187, 196
NlaIII CATG 1 cut(s) 344
NmuCI GTSAC 1 cut(s) 6
PfeI GAWTC 3 cut(s) 251, 410, 486
PleI GAGTC 1 cut(s) 460
PpsI GAGTC 1 cut(s) 460
PspPI GGNCC 1 cut(s) 264
PstI CTGCAG 1 cut(s) 232
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
SaqAI TTAA 1 cut(s) 420
Sau3AI GATC 2 cut(s) 187, 196
Sau96I GGNCC 1 cut(s) 264
SchI GAGTC 1 cut(s) 461
SfcI CTRYAG 1 cut(s) 228
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
Sse9I AATT 1 cut(s) 468
SspI AATATT 1 cut(s) 388
SspMI CTAG 2 cut(s) 158, 201
TaaI ACNGT 1 cut(s) 418
TaiI ACGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 413
TasI AATT 1 cut(s) 468
TatI WGTACW 1 cut(s) 36
TfiI GAWTC 3 cut(s) 251, 410, 486
Tru1I TTAA 1 cut(s) 420
Tru9I TTAA 1 cut(s) 420
TscAI CASTG 2 cut(s) 213, 364
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 3 cut(s) 168, 302, 354
TspRI CASTG 2 cut(s) 213, 364
XapI RAATTY 1 cut(s) 468
XspI CTAG 2 cut(s) 158, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.