Rmu_sc0004082.1_g000015

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004082.1
OG0000413
Physical Location & Seq
Reverse (-)
64950 .. 65714
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004082.1_g000015.1.cds

Sequence Viewer

Length: 765 bp
atgaccatttgtcttgggttgaaggcagtcataatcagctccgttctcaatctagattatcttgggttgaagatatctttcaatgaaattcagtttgcaatgaacaactttgacacaaagttggtgataggtaagggtggctttgggaatgtttatagaggcactcttttgaatggcacaaaagtggctgttaagcgagcttataagcaagatgagcatgggtcaggatcaggatcaggcgaaggccttatagaattcgaaacagaaatcatagttttatcaaaaatcctccaccgccatcttgtctccttaattggttactgtaatgaaatgtctgaaatgatactagtgtatgagttcatggaaaaagggacgttgagagatcatttgtatgatttagatgtgcctcgcttgttgtggaatcaaagacttgaaatttgtactggagcagcaaggggtcttcattatctccacacaggtgcaggtaggggaatcattcaccgagatgtcaagtccaccaacatattgcttgatgaaaaccatgttgccaaagttgctgactttggcctttcgagatttggagctctcgatgaaacgcatgttagcactaatgttaaaggaacttttggttaccttgatcctgagtacatgatgtctgaacaattgacagaaaaatctgatgtttactcatttggtgtagttcttcttgaggtgttatgtggaagacctgctattgatccaatgcttcaaagagagcaatgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Malectin_like Pkinase Pkinase_Tyr

Protein Analysis

254

Amino Acids

28.31

Weight (kDa)

5.85

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000413)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G23200
fragaria_vesca FvH4_1g16860 FvH4_1g16861
malus_domestica MD02G1018900.v1.1 MD15G1289500.v1.1 MD15G1289600.v1.1 MD15G1289700.v1.1
prunus_persica Prupe.6G227800_v2.0.a1 Prupe.6G228000_v2.0.a1 Prupe.6G228100_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228200_v2.0.a1 Prupe.6G228300_v2.0.a1
pyrus_communis pycom02g01680 pycom02g01690 pycom15g25310 pycom15g25330 pycom15g25340
rosa_chinensis RchiOBHm_Chr1g0324321 RchiOBHm_Chr1g0324331 RchiOBHm_Chr1g0324341 RchiOBHm_Chr1g0324401 RchiOBHm_Chr1g0324441 RchiOBHm_Chr2g0106751 RchiOBHm_Chr2g0106761 RchiOBHm_Chr2g0106771 RchiOBHm_Chr2g0106781 RchiOBHm_Chr2g0106801 RchiOBHm_Chr2g0106811 RchiOBHm_Chr2g0106821
rosa_laevigata RLG00000017539 RLG00000017540 RLG00000017541 RLG00000030200 RLG00000030201
rosa_multiflora Rmu_sc0000751.1_g000001 Rmu_sc0000751.1_g000002 Rmu_sc0000751.1_g000003 Rmu_sc0000751.1_g000005 Rmu_sc0000751.1_g000007 Rmu_sc0000751.1_g000008 Rmu_sc0000751.1_g000018 Rmu_sc0000751.1_g000019 Rmu_sc0000751.1_g000026 Rmu_sc0000751.1_g000027 Rmu_sc0000751.1_g000028 Rmu_sc0000751.1_g000029 Rmu_sc0003410.1_g000012 Rmu_sc0004000.1_g000023 Rmu_sc0004000.1_g000024 Rmu_sc0004082.1_g000015 Rmu_sc0004082.1_g000017 Rmu_sc0026507.1_g000001 Rmu_sc0031196.1_g000001 Rmu_sc0039591.1_g000001
rosa_roxburghii Rroxscaffold_159G00432710 Rroxscaffold_159G00432780 Rroxscaffold_159G00432840 Rroxscaffold_159G00433010 Rroxscaffold_2G00098070 Rroxscaffold_2G00136770 Rroxscaffold_4G00325540 Rroxscaffold_4G00325630 Rroxscaffold_4G00325680
rosa_rugosa Rorug01G0045700 Rorug02G0138500 Rorug02G0138600 Rorug02G0138700 Rorug02G0138800 Rorug02G0138900
rosa_samantha Rh1AG061400 Rh1BG052300 Rh1CG063400 Rh1CG063700 Rh1DG067800 Rh2AG189400 Rh2AG189800 Rh2AG190000 Rh2AG190100 Rh2BG201100 Rh2BG201300 Rh2CG194500 Rh2CG194600 Rh2CG194700 Rh2DG195700 Rh2DG195900 Rh2DG196300 Rh2DG196400 Rh2DG196500 Rh2DG196600
rosa_wichuraiana Rw1G004230 Rw1G005210 Rw2G014900 Rw2G014910 Rw2G014930 Rw2G014940 Rw2G014950 Rw2G014960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 204
Acc36I ACCTGC 2 cut(s) 473, 736
AciI CCGC 1 cut(s) 295
AclWI GGATC 4 cut(s) 235, 241, 632, 731
AcsI RAATTY 3 cut(s) 87, 254, 435
AfaI GTAC 2 cut(s) 442, 647
AgsI TTSAA 6 cut(s) 22, 70, 82, 172, 434, 749
AhdI GACNNNNNGTC 1 cut(s) 9
AhlI ACTAGT 1 cut(s) 346
AleI CACNNNNGTG 2 cut(s) 182, 477
AluBI AGCT 3 cut(s) 39, 200, 584
AluI AGCT 3 cut(s) 39, 200, 584
Alw21I GWGCWC 1 cut(s) 586
Alw26I GTCTC 1 cut(s) 310
AlwI GGATC 4 cut(s) 235, 241, 632, 731
AoxI GGCC 2 cut(s) 244, 565
ApeKI GCWGC 1 cut(s) 449
ApoI RAATTY 3 cut(s) 87, 254, 435
ArsI GACNNNNNNTTYG 2 cut(s) 420, 452
AsuHPI GGTGA 2 cut(s) 136, 491
AsuII TTCGAA 1 cut(s) 258
BaeI ACNNNNGTAYC 2 cut(s) 335, 368
BanII GRGCYC 1 cut(s) 586
BbsI GAAGAC 2 cut(s) 452, 730
Bbv12I GWGCWC 1 cut(s) 586
BbvI GCAGC 1 cut(s) 461
BccI CCATC 1 cut(s) 306
BcoDI GTCTC 1 cut(s) 310
BcuI ACTAGT 1 cut(s) 346
BfaI CTAG 2 cut(s) 53, 347
BfuAI ACCTGC 2 cut(s) 473, 736
BisI GCNGC 1 cut(s) 450
BlsI GCNGC 1 cut(s) 451
BmeRI GACNNNNNGTC 1 cut(s) 9
BpiI GAAGAC 2 cut(s) 452, 730
BpmI CTGGAG 1 cut(s) 465
Bpu14I TTCGAA 1 cut(s) 258
BpuEI CTTGAG 1 cut(s) 728
BsaBI GATNNNNATC 1 cut(s) 232
Bse1I ACTGG 1 cut(s) 448
Bse3DI GCAATG 2 cut(s) 105, 764
Bse8I GATNNNNATC 1 cut(s) 232
BseJI GATNNNNATC 1 cut(s) 232
BseMI GCAATG 2 cut(s) 105, 764
BseMII CTCAG 1 cut(s) 633
BseNI ACTGG 1 cut(s) 448
BseXI GCAGC 1 cut(s) 461
BsgI GTGCAG 1 cut(s) 501
BshFI GGCC 2 cut(s) 246, 567
BsiHKAI GWGCWC 1 cut(s) 586
BslFI GGGAC 1 cut(s) 385
BsmAI GTCTC 1 cut(s) 310
BsmFI GGGAC 1 cut(s) 385
BsnI GGCC 2 cut(s) 246, 567
Bsp119I TTCGAA 1 cut(s) 258
Bsp1286I GDGCHC 1 cut(s) 586
Bsp143I GATC 5 cut(s) 227, 233, 382, 637, 736
BspACI CCGC 1 cut(s) 295
BspANI GGCC 2 cut(s) 246, 567
BspCNI CTCAG 1 cut(s) 634
BspMI ACCTGC 2 cut(s) 473, 736
BspPI GGATC 4 cut(s) 235, 241, 632, 731
BspT104I TTCGAA 1 cut(s) 258
BsrDI GCAATG 2 cut(s) 105, 764
BsrI ACTGG 1 cut(s) 448
BssMI GATC 5 cut(s) 227, 233, 382, 637, 736
Bst4CI ACNGT 1 cut(s) 323
BstBI TTCGAA 1 cut(s) 258
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 642
BstEII GGTNACC 1 cut(s) 629
BstKTI GATC 5 cut(s) 230, 236, 385, 640, 739
BstMAI GTCTC 1 cut(s) 310
BstMBI GATC 5 cut(s) 227, 233, 382, 637, 736
BstMWI GCNNNNNNNGC 2 cut(s) 214, 554
BstNSI RCATGY 1 cut(s) 602
BstPI GGTNACC 1 cut(s) 629
BstV1I GCAGC 1 cut(s) 461
BstV2I GAAGAC 2 cut(s) 452, 730
BsuRI GGCC 2 cut(s) 246, 567
BveI ACCTGC 2 cut(s) 473, 736
Cac8I GCNNGC 1 cut(s) 198
Csp6I GTAC 2 cut(s) 441, 646
CviAII CATG 5 cut(s) 218, 361, 542, 599, 649
CviJI RGCY 7 cut(s) 39, 141, 188, 200, 246, 567, 584
CviKI_1 RGCY 7 cut(s) 39, 141, 188, 200, 246, 567, 584
CviQI GTAC 2 cut(s) 441, 646
DdeI CTNAG 1 cut(s) 642
DpnI GATC 5 cut(s) 229, 235, 384, 639, 738
DpnII GATC 5 cut(s) 227, 233, 382, 637, 736
DriI GACNNNNNGTC 1 cut(s) 9
Eam1105I GACNNNNNGTC 1 cut(s) 9
Ecl136II GAGCTC 1 cut(s) 584
Eco147I AGGCCT 1 cut(s) 246
Eco24I GRGCYC 1 cut(s) 586
Eco32I GATATC 1 cut(s) 75
Eco53kI GAGCTC 1 cut(s) 584
Eco91I GGTNACC 1 cut(s) 629
EcoICRI GAGCTC 1 cut(s) 584
EcoO65I GGTNACC 1 cut(s) 629
EcoRI GAATTC 1 cut(s) 254
EcoRV GATATC 1 cut(s) 75
EcoT38I GRGCYC 1 cut(s) 586
FaeI CATG 5 cut(s) 221, 364, 545, 602, 652
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FaqI GGGAC 1 cut(s) 385
FatI CATG 5 cut(s) 217, 360, 541, 598, 648
Fnu4HI GCNGC 1 cut(s) 450
FriOI GRGCYC 1 cut(s) 586
Fsp4HI GCNGC 1 cut(s) 450
FspBI CTAG 2 cut(s) 53, 347
GluI GCNGC 1 cut(s) 450
GsuI CTGGAG 1 cut(s) 465
HaeIII GGCC 2 cut(s) 246, 567
Hin1II CATG 5 cut(s) 221, 364, 545, 602, 652
HinfI GANTC 2 cut(s) 421, 492
HphI GGTGA 2 cut(s) 136, 491
Hpy166II GTNNAC 2 cut(s) 516, 685
Hpy188I TCNGA 3 cut(s) 337, 658, 679
Hpy188III TCNNGA 7 cut(s) 53, 225, 231, 573, 587, 641, 707
Hpy8I GTNNAC 2 cut(s) 516, 685
HpyAV CCTTC 2 cut(s) 16, 236
HpyCH4III ACNGT 1 cut(s) 323
HpyCH4IV ACGT 1 cut(s) 374
HpyCH4V TGCA 2 cut(s) 98, 482
HpyF10VI GCNNNNNNNGC 2 cut(s) 214, 554
HpyF3I CTNAG 1 cut(s) 642
HpySE526I ACGT 1 cut(s) 374
Hsp92II CATG 5 cut(s) 221, 364, 545, 602, 652
Kzo9I GATC 5 cut(s) 227, 233, 382, 637, 736
LmnI GCTCC 3 cut(s) 44, 446, 581
LpnPI CCDG 8 cut(s) 210, 216, 222, 429, 462, 468, 654, 741
Lsp1109I GCAGC 1 cut(s) 461
MaeI CTAG 2 cut(s) 53, 347
MaeII ACGT 1 cut(s) 374
MaeIII GTNAC 2 cut(s) 317, 629
MalI GATC 5 cut(s) 229, 235, 384, 639, 738
MboI GATC 5 cut(s) 227, 233, 382, 637, 736
MboII GAAGA 4 cut(s) 82, 452, 695, 735
MfeI CAATTG 1 cut(s) 662
MhlI GDGCHC 1 cut(s) 586
MluCI AATT 5 cut(s) 87, 254, 312, 435, 662
MnlI CCTC 4 cut(s) 152, 299, 417, 703
MseI TTAA 4 cut(s) 192, 311, 615, 763
MslI CAYNNNNRTG 4 cut(s) 182, 390, 477, 504
MunI CAATTG 1 cut(s) 662
MwoI GCNNNNNNNGC 2 cut(s) 214, 554
NdeII GATC 5 cut(s) 227, 233, 382, 637, 736
NlaIII CATG 5 cut(s) 221, 364, 545, 602, 652
NspI RCATGY 1 cut(s) 602
NspV TTCGAA 1 cut(s) 258
OliI CACNNNNGTG 2 cut(s) 182, 477
PceI AGGCCT 1 cut(s) 246
PfeI GAWTC 2 cut(s) 421, 492
PkrI GCNGC 1 cut(s) 451
PsiI TTATAA 1 cut(s) 204
Psp124BI GAGCTC 1 cut(s) 586
PspEI GGTNACC 1 cut(s) 629
RsaI GTAC 2 cut(s) 442, 647
RsaNI GTAC 2 cut(s) 441, 646
RseI CAYNNNNRTG 4 cut(s) 182, 390, 477, 504
SacI GAGCTC 1 cut(s) 586
SaqAI TTAA 4 cut(s) 192, 311, 615, 763
SatI GCNGC 1 cut(s) 450
Sau3AI GATC 5 cut(s) 227, 233, 382, 637, 736
SduI GDGCHC 1 cut(s) 586
SfuI TTCGAA 1 cut(s) 258
SmiMI CAYNNNNRTG 4 cut(s) 182, 390, 477, 504
SmlI CTYRAG 1 cut(s) 707
SmoI CTYRAG 1 cut(s) 707
SpeI ACTAGT 1 cut(s) 346
Sse9I AATT 5 cut(s) 87, 254, 312, 435, 662
SseBI AGGCCT 1 cut(s) 246
SsiI CCGC 1 cut(s) 295
SspMI CTAG 2 cut(s) 53, 347
SstI GAGCTC 1 cut(s) 586
StuI AGGCCT 1 cut(s) 246
TaaI ACNGT 1 cut(s) 323
TaiI ACGT 1 cut(s) 377
TaqI TCGA 3 cut(s) 258, 572, 588
TasI AATT 5 cut(s) 87, 254, 312, 435, 662
TatI WGTACW 2 cut(s) 440, 645
TfiI GAWTC 2 cut(s) 421, 492
Tru1I TTAA 4 cut(s) 192, 311, 615, 763
Tru9I TTAA 4 cut(s) 192, 311, 615, 763
TseI GCWGC 1 cut(s) 449
TspDTI ATGAA 7 cut(s) 99, 116, 342, 349, 452, 549, 606
TspGWI ACGGA 1 cut(s) 31
XapI RAATTY 3 cut(s) 87, 254, 435
XbaI TCTAGA 1 cut(s) 52
XceI RCATGY 1 cut(s) 602
XspI CTAG 2 cut(s) 53, 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.