Rmu_sc0001168.1_g000008

Belongs to the eIF-2B alpha beta delta subunits family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001168.1
Physical Location & Seq
Reverse (-)
27204 .. 33583
6380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001168.1_g000008.1.cds

Sequence Viewer

Length: 1254 bp
atgccagacgtgcatactcttgtgaatgatttcattatcaagctgaaaaagcgtaaaatcgagggctcgcaggctacggcgaagcagactgctgagttacttcgcccggtgatttcgtcgcagcgtgtgccctacacgaatcaagccggagccttgattgatgctgtaaaggctgttggggagcagctgattgctgcaaatcctgtggagcttgctgtgggtaatattgtgaggcgggttttgcacattatcagggaggaggatctttctctcaccacagctgctatggctgggttgaacttgtcaactgtcagtgatgatgaagatgatgttgaccacgacaactatcctgttctatctgctgctgtagttgcagcagctgcaagaagcacactgcgtccgccttccttgcaaacccttcttgaagacatgcctgatgcagcagctatccctcacacttcttcatctgggggtgattctgaaggaaaaagcaaatctgctgataaaagttctagaagccggaagctgaagcatgatgtcattgaagcagtcaatgaacttattcaagatattggcacttgccatgaacagattgctgagcaagcagtagagcacattcaccataatgaggttatattaactctaggcagttcaaaaacagtactagaattcctttttgctgcaaaggagaaaaaaagatcatttcgggtatttgttgcagagggagctccaaggtatcaggggcatcttcttgcaaaagaattggttgcaagaggtttacaaaccacgctgatcactgattctgcaatttttgctatgatatctcgagtgaacatggttatagttggtgctcatgctgtcatggccaatggtggtgttatagcacctgttgggttgaatatggttgcacttgcagcccaaagacatgccgtcccttttgttgtacttgctggcagtcacaagttgtgccctctgtatccacacaaccctgaagtcttgctgaatgagttaagatctccttctgagctgctagattttggagaattctcagattgcatggattttcgaagtggcactggttccccacttctgcatgttgtcaatcctacatttgattttgtgccaccaaagcttgttagtctatttatcactgatactggaggccataatccatcatacatgtaccggctcatcgcagattattactctgctgatgatttggttgtccaacgaagacctgctacagggagctga

Protein Analysis

417

Amino Acids

45.05

Weight (kDa)

5.97

Isoelectric Point (pI)

51.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000605)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G07300 AT3G07300 AT3G07300
fragaria_vesca FvH4_1g26370 FvH4_4g04150 FvH4_7g02780 FvH4_7g02780 FvH4_7g02780 FvH4_7g02780
malus_domestica MD02G1290200.v1.1 MD07G1036800.v1.1 MD13G1218100.v1.1 MD13G1218200.v1.1
prunus_persica Prupe.1G044800_v2.0.a1 Prupe.2G032300_v2.0.a1 Prupe.2G032300_v2.0.a1 Prupe.2G032300_v2.0.a1
pyrus_communis pycom07g02550
rosa_chinensis RchiOBHm_Chr1g0313651 RchiOBHm_Chr1g0322021 RchiOBHm_Chr1g0322871 RchiOBHm_Chr1g0322881 RchiOBHm_Chr1g0378031 RchiOBHm_Chr2g0146721 RchiOBHm_Chr4g0394571 RchiOBHm_Chr4g0444661
rosa_laevigata RLG00000009689 RLG00000014710 RLG00000020215 RLG00000028674 RLG00000030393
rosa_multiflora Rmu_sc0001168.1_g000008 Rmu_sc0001168.1_g000019 Rmu_sc0001986.1_g000042 Rmu_sc0005424.1_g000018
rosa_roxburghii Rroxscaffold_1G00066950 Rroxscaffold_4G00308160 Rroxscaffold_4G00327340 Rroxscaffold_4G00331500 Rroxscaffold_5G00339610 Rroxscaffold_5G00370190 Rroxscaffold_6G00400520 Rroxscaffold_7G00188200
rosa_rugosa Rorug01G0035100 Rorug01G0035200 Rorug01G0131800.1 Rorug01G0193700 Rorug03G0291700 Rorug03G0291800 Rorug03G0291800 Rorug03G0291900 Rorug03G0364400.1 Rorug04G0439300 Rorug04G0439400 Rorug05G0543000 Rorug07G0306800
rosa_samantha Rh1AG048400 Rh1AG309400 Rh1AG358100 Rh1AG424800 Rh1BG046200 Rh1CG052500 Rh1DG056700 Rh2AG452600 Rh2BG465300 Rh2CG439500 Rh2DG245700 Rh2DG245800 Rh2DG474300 Rh4AG053000 Rh4BG050900 Rh4CG057700 Rh4DG049700 Rh5BG052500 Rh5DG543800 Rh6DG164300 Rh7AG422900 Rh7BG328900
rosa_wichuraiana Rw1G004380 Rw4G004270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 1246
AciI CCGC 2 cut(s) 235, 401
AclWI GGATC 1 cut(s) 270
AcoI YGGCCR 1 cut(s) 864
AcsI RAATTY 2 cut(s) 668, 1043
AcuI CTGAAG 3 cut(s) 501, 548, 1011
AfaI GTAC 3 cut(s) 663, 945, 1184
AfiI CCNNNNNNNGG 2 cut(s) 628, 1244
AflIII ACRYGT 1 cut(s) 1179
AgsI TTSAA 6 cut(s) 298, 425, 545, 566, 654, 898
AhdI GACNNNNNGTC 1 cut(s) 929
AjiI CACGTC 1 cut(s) 10
Alw21I GWGCWC 3 cut(s) 615, 730, 853
AlwI GGATC 1 cut(s) 270
AlwNI CAGNNNCTG 1 cut(s) 380
Ama87I CYCGRG 1 cut(s) 825
AoxI GGCC 2 cut(s) 864, 1162
ApoI RAATTY 2 cut(s) 668, 1043
Asp700I GAANNNNTTC 2 cut(s) 29, 561
AsuC2I CCSGG 1 cut(s) 107
AsuHPI GGTGA 4 cut(s) 121, 265, 485, 611
AsuII TTCGAA 1 cut(s) 1066
AvaI CYCGRG 1 cut(s) 825
BaeGI GKGCMC 2 cut(s) 132, 971
BalI TGGCCA 1 cut(s) 866
BanII GRGCYC 2 cut(s) 68, 730
BarI GAAGNNNNNNTAC 1 cut(s) 1225
BbsI GAAGAC 2 cut(s) 432, 1240
Bbv12I GWGCWC 3 cut(s) 615, 730, 853
BccI CCATC 1 cut(s) 1180
BceAI ACGGC 2 cut(s) 93, 914
BciVI GTATCC 1 cut(s) 987
BclI TGATCA 1 cut(s) 792
BcnI CCSGG 1 cut(s) 107
BfaI CTAG 4 cut(s) 513, 644, 665, 1031
BfmI CTRYAG 2 cut(s) 366, 1242
BfuAI ACCTGC 1 cut(s) 1246
BfuI GTATCC 1 cut(s) 987
BglII AGATCT 1 cut(s) 1013
BlpI GCTNAGC 1 cut(s) 597
BmcAI AGTACT 1 cut(s) 663
Bme1390I CCNGG 1 cut(s) 107
BmeRI GACNNNNNGTC 1 cut(s) 929
BmeT110I CYCGRG 1 cut(s) 825
BmgBI CACGTC 1 cut(s) 10
BmiI GGNNCC 2 cut(s) 151, 1081
BmrFI CCNGG 1 cut(s) 107
BmsI GCATC 3 cut(s) 151, 427, 754
BpiI GAAGAC 2 cut(s) 432, 1240
BpmI CTGGAG 1 cut(s) 1179
Bpu1102I GCTNAGC 1 cut(s) 597
Bpu14I TTCGAA 1 cut(s) 1066
BpuMI CCSGG 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 731
Bsc4I CCNNNNNNNGG 2 cut(s) 628, 1244
Bse118I RCCGGY 1 cut(s) 1185
Bse1I ACTGG 2 cut(s) 1081, 1162
BseDI CCNNGG 1 cut(s) 731
BseLI CCNNNNNNNGG 2 cut(s) 628, 1244
BseMII CTCAG 4 cut(s) 84, 588, 1014, 1062
BseNI ACTGG 2 cut(s) 1081, 1162
BseRI GAGGAG 1 cut(s) 272
BseSI GKGCMC 2 cut(s) 132, 971
BseYI CCCAGC 1 cut(s) 290
BshFI GGCC 2 cut(s) 866, 1164
BsiHKAI GWGCWC 3 cut(s) 615, 730, 853
BsiHKCI CYCGRG 1 cut(s) 825
BsiSI CCGG 4 cut(s) 107, 147, 520, 1186
BslFI GGGAC 1 cut(s) 917
BslI CCNNNNNNNGG 2 cut(s) 628, 1244
BsmFI GGGAC 1 cut(s) 917
BsnI GGCC 2 cut(s) 866, 1164
BsoBI CYCGRG 1 cut(s) 825
Bsp119I TTCGAA 1 cut(s) 1066
Bsp1286I GDGCHC 6 cut(s) 68, 132, 615, 730, 853, 971
Bsp143I GATC 4 cut(s) 262, 698, 792, 1013
Bsp1720I GCTNAGC 1 cut(s) 597
BspACI CCGC 2 cut(s) 235, 401
BspANI GGCC 2 cut(s) 866, 1164
BspCNI CTCAG 4 cut(s) 85, 589, 1015, 1061
BspLI GGNNCC 2 cut(s) 151, 1081
BspMI ACCTGC 1 cut(s) 1246
BspPI GGATC 1 cut(s) 270
BspT104I TTCGAA 1 cut(s) 1066
BsrFI RCCGGY 1 cut(s) 1185
BsrI ACTGG 2 cut(s) 1081, 1162
BssAI RCCGGY 1 cut(s) 1185
BssECI CCNNGG 1 cut(s) 731
BssMI GATC 4 cut(s) 262, 698, 792, 1013
BssT1I CCWWGG 1 cut(s) 731
Bst4CI ACNGT 2 cut(s) 310, 661
BstAPI GCANNNNNTGC 3 cut(s) 127, 380, 812
BstBI TTCGAA 1 cut(s) 1066
BstC8I GCNNGC 5 cut(s) 68, 72, 213, 603, 952
BstDEI CTNAG 4 cut(s) 93, 597, 1023, 1048
BstENI CCTNNNNNAGG 1 cut(s) 1242
BstKTI GATC 4 cut(s) 265, 701, 795, 1016
BstMBI GATC 4 cut(s) 262, 698, 792, 1013
BstNSI RCATGY 4 cut(s) 433, 929, 1097, 1183
BstSCI CCNGG 1 cut(s) 105
BstSFI CTRYAG 2 cut(s) 366, 1242
BstSLI GKGCMC 2 cut(s) 132, 971
BstV2I GAAGAC 2 cut(s) 432, 1240
BstX2I RGATCY 2 cut(s) 262, 1013
BstYI RGATCY 2 cut(s) 262, 1013
BsuI GTATCC 1 cut(s) 987
BsuRI GGCC 2 cut(s) 866, 1164
BtgZI GCGATG 1 cut(s) 1177
BtrI CACGTC 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 392
BtsIMutI CAGTG 5 cut(s) 319, 392, 795, 1074, 1149
BveI ACCTGC 1 cut(s) 1246
Cac8I GCNNGC 5 cut(s) 68, 72, 213, 603, 952
CaiI CAGNNNCTG 1 cut(s) 380
Cfr10I RCCGGY 1 cut(s) 1185
CseI GACGC 1 cut(s) 386
Csp6I GTAC 3 cut(s) 662, 944, 1183
CspCI CAANNNNNGTGG 2 cut(s) 186, 221
CviQI GTAC 3 cut(s) 662, 944, 1183
DdeI CTNAG 4 cut(s) 93, 597, 1023, 1048
DpnI GATC 4 cut(s) 264, 700, 794, 1015
DpnII GATC 4 cut(s) 262, 698, 792, 1013
DriI GACNNNNNGTC 1 cut(s) 929
EaeI YGGCCR 1 cut(s) 864
Eam1105I GACNNNNNGTC 1 cut(s) 929
EciI GGCGGA 1 cut(s) 390
Ecl136II GAGCTC 1 cut(s) 728
Eco130I CCWWGG 1 cut(s) 731
Eco24I GRGCYC 2 cut(s) 68, 730
Eco32I GATATC 1 cut(s) 822
Eco53kI GAGCTC 1 cut(s) 728
Eco57I CTGAAG 3 cut(s) 501, 548, 1011
Eco88I CYCGRG 1 cut(s) 825
EcoICRI GAGCTC 1 cut(s) 728
EcoNI CCTNNNNNAGG 1 cut(s) 1242
EcoRI GAATTC 2 cut(s) 668, 1043
EcoRV GATATC 1 cut(s) 822
EcoT14I CCWWGG 1 cut(s) 731
EcoT38I GRGCYC 2 cut(s) 68, 730
ErhI CCWWGG 1 cut(s) 731
FalI AAGNNNNNCTT 2 cut(s) 1003, 1035
FaqI GGGAC 1 cut(s) 917
FauI CCCGC 1 cut(s) 228
FbaI TGATCA 1 cut(s) 792
FriOI GRGCYC 2 cut(s) 68, 730
FspBI CTAG 4 cut(s) 513, 644, 665, 1031
GsaI CCCAGC 1 cut(s) 294
GsuI CTGGAG 1 cut(s) 1179
HaeIII GGCC 2 cut(s) 866, 1164
HapII CCGG 4 cut(s) 107, 147, 520, 1186
HgaI GACGC 1 cut(s) 386
HincII GTYRAC 2 cut(s) 306, 334
HindII GTYRAC 2 cut(s) 306, 334
HindIII AAGCTT 1 cut(s) 1130
HinfI GANTC 3 cut(s) 139, 476, 800
HpaII CCGG 4 cut(s) 107, 147, 520, 1186
HphI GGTGA 4 cut(s) 121, 265, 485, 611
Hpy166II GTNNAC 4 cut(s) 306, 334, 779, 832
Hpy188I TCNGA 3 cut(s) 481, 1024, 1051
Hpy188III TCNNGA 4 cut(s) 422, 513, 566, 825
Hpy8I GTNNAC 4 cut(s) 306, 334, 779, 832
Hpy99I CGWCG 1 cut(s) 121
HpyAV CCTTC 4 cut(s) 414, 428, 476, 1029
HpyCH4III ACNGT 2 cut(s) 310, 661
HpyCH4IV ACGT 1 cut(s) 9
HpyF3I CTNAG 4 cut(s) 93, 597, 1023, 1048
HpySE526I ACGT 1 cut(s) 9
Ksp22I TGATCA 1 cut(s) 792
Kzo9I GATC 4 cut(s) 262, 698, 792, 1013
LmnI GCTCC 6 cut(s) 149, 181, 208, 725, 733, 1248
LweI GCATC 3 cut(s) 151, 427, 754
MaeI CTAG 4 cut(s) 513, 644, 665, 1031
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 2 cut(s) 96, 956
MalI GATC 4 cut(s) 264, 700, 794, 1015
MboI GATC 4 cut(s) 262, 698, 792, 1013
MboII GAAGA 5 cut(s) 335, 437, 453, 740, 1245
MflI RGATCY 2 cut(s) 262, 1013
MhlI GDGCHC 6 cut(s) 68, 132, 615, 730, 853, 971
MlsI TGGCCA 1 cut(s) 866
MluCI AATT 4 cut(s) 668, 761, 807, 1043
MluNI TGGCCA 1 cut(s) 866
MmeI TCCRAC 1 cut(s) 1252
Mox20I TGGCCA 1 cut(s) 866
MroXI GAANNNNTTC 2 cut(s) 29, 561
MscI TGGCCA 1 cut(s) 866
MseI TTAA 2 cut(s) 638, 1010
MslI CAYNNNNRTG 1 cut(s) 624
Msp20I TGGCCA 1 cut(s) 866
MspA1I CMGCKG 3 cut(s) 187, 281, 380
MspI CCGG 4 cut(s) 107, 147, 520, 1186
MspR9I CCNGG 1 cut(s) 107
NciI CCSGG 1 cut(s) 107
NdeII GATC 4 cut(s) 262, 698, 792, 1013
NlaIV GGNNCC 2 cut(s) 151, 1081
NmuCI GTSAC 1 cut(s) 956
NspI RCATGY 4 cut(s) 433, 929, 1097, 1183
NspV TTCGAA 1 cut(s) 1066
PaeR7I CTCGAG 1 cut(s) 825
PciI ACATGT 1 cut(s) 1179
PdmI GAANNNNTTC 2 cut(s) 29, 561
PfeI GAWTC 3 cut(s) 139, 476, 800
PscI ACATGT 1 cut(s) 1179
Psp124BI GAGCTC 1 cut(s) 730
PspFI CCCAGC 1 cut(s) 290
PspN4I GGNNCC 2 cut(s) 151, 1081
PstNI CAGNNNCTG 1 cut(s) 380
PsuI RGATCY 2 cut(s) 262, 1013
PvuII CAGCTG 3 cut(s) 187, 281, 380
RsaI GTAC 3 cut(s) 663, 945, 1184
RsaNI GTAC 3 cut(s) 662, 944, 1183
RseI CAYNNNNRTG 1 cut(s) 624
SacI GAGCTC 1 cut(s) 730
SaqAI TTAA 2 cut(s) 638, 1010
Sau3AI GATC 4 cut(s) 262, 698, 792, 1013
ScaI AGTACT 1 cut(s) 663
ScrFI CCNGG 1 cut(s) 107
SduI GDGCHC 6 cut(s) 68, 132, 615, 730, 853, 971
SfaNI GCATC 3 cut(s) 151, 427, 754
SfcI CTRYAG 2 cut(s) 366, 1242
Sfr274I CTCGAG 1 cut(s) 825
SfuI TTCGAA 1 cut(s) 1066
SlaI CTCGAG 1 cut(s) 825
SmiMI CAYNNNNRTG 1 cut(s) 624
SmlI CTYRAG 1 cut(s) 825
SmoI CTYRAG 1 cut(s) 825
Sse9I AATT 4 cut(s) 668, 761, 807, 1043
SsiI CCGC 2 cut(s) 235, 401
SspI AATATT 1 cut(s) 226
SspMI CTAG 4 cut(s) 513, 644, 665, 1031
SstI GAGCTC 1 cut(s) 730
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 731
TaaI ACNGT 2 cut(s) 310, 661
TaiI ACGT 1 cut(s) 12
TaqI TCGA 3 cut(s) 60, 826, 1066
TasI AATT 4 cut(s) 668, 761, 807, 1043
TatI WGTACW 2 cut(s) 661, 943
TfiI GAWTC 3 cut(s) 139, 476, 800
Tru1I TTAA 2 cut(s) 638, 1010
Tru9I TTAA 2 cut(s) 638, 1010
TscAI CASTG 5 cut(s) 319, 399, 802, 1081, 1156
TseFI GTSAC 1 cut(s) 956
Tsp45I GTSAC 1 cut(s) 956
TspDTI ATGAA 5 cut(s) 22, 336, 453, 570, 600
TspRI CASTG 5 cut(s) 319, 399, 802, 1081, 1156
XagI CCTNNNNNAGG 1 cut(s) 1242
XapI RAATTY 2 cut(s) 668, 1043
XbaI TCTAGA 1 cut(s) 512
XceI RCATGY 4 cut(s) 433, 929, 1097, 1183
XcmI CCANNNNNNNNNTGG 1 cut(s) 283
XhoI CTCGAG 1 cut(s) 825
XmnI GAANNNNTTC 2 cut(s) 29, 561
XspI CTAG 4 cut(s) 513, 644, 665, 1031
ZrmI AGTACT 1 cut(s) 663
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.