Rmu_sc0002560.1_g000015

B3 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002560.1
Physical Location & Seq
Forward (+)
66016 .. 66669
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002560.1_g000015.1.cds

Sequence Viewer

Length: 519 bp
atgtggaatcgctttgtgcaagacaatggcttgaagtatggtaaacttctagtcttccgttatgctggaaaaccagtcttccatgtggacctattcaaaataaatacatgcaaaaagctgtgtgtaattcctgagatggaaggagctgatgaacatgatgatgatgtatcccttgacatcttgcacggctttccaccctgcccaagaagaacagaggagaaatctttgctttcaagttttctgcctcacaagacaaacaaaacaagttctagtggtagagcagatatcacccccaactttcgaaaaagggttccacatcttgaaaatgccaaaaagactaatcatgttatcaattccatccattatgacttacctgcagataattctgatactgaatctgctgatgaagatgatcaggatgacgacaaaaatgaagatgaagaaactcaagatgaagagattgaggaggaaaatgatggtgattctgttgaaaccctcaacgattctctaccatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.6

Weight (kDa)

4.58

Isoelectric Point (pI)

48.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 382
AgsI TTSAA 5 cut(s) 34, 97, 234, 323, 491
AluBI AGCT 2 cut(s) 118, 146
AluI AGCT 2 cut(s) 118, 146
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 2 cut(s) 280, 491
AsuII TTCGAA 1 cut(s) 301
AvaII GGWCC 1 cut(s) 88
BbsI GAAGAC 2 cut(s) 46, 70
BccI CCATC 3 cut(s) 130, 365, 470
BceAI ACGGC 1 cut(s) 202
BciVI GTATCC 1 cut(s) 178
BclI TGATCA 1 cut(s) 412
BfaI CTAG 2 cut(s) 50, 270
BfmI CTRYAG 1 cut(s) 375
BfuAI ACCTGC 1 cut(s) 382
BfuI GTATCC 1 cut(s) 178
Bme18I GGWCC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 312
BpiI GAAGAC 2 cut(s) 46, 70
Bpu14I TTCGAA 1 cut(s) 301
BpuEI CTTGAG 1 cut(s) 432
Bse1I ACTGG 1 cut(s) 74
BseGI GGATG 2 cut(s) 357, 424
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 74
BseRI GAGGAG 2 cut(s) 230, 479
Bsp119I TTCGAA 1 cut(s) 301
Bsp143I GATC 1 cut(s) 412
BspCNI CTCAG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 312
BspMAI CTGCAG 1 cut(s) 379
BspMI ACCTGC 1 cut(s) 382
BspT104I TTCGAA 1 cut(s) 301
BsrI ACTGG 1 cut(s) 74
BssMI GATC 1 cut(s) 412
Bst6I CTCTTC 1 cut(s) 450
BstBI TTCGAA 1 cut(s) 301
BstDEI CTNAG 2 cut(s) 132, 516
BstF5I GGATG 2 cut(s) 357, 424
BstKTI GATC 1 cut(s) 415
BstMBI GATC 1 cut(s) 412
BstNSI RCATGY 1 cut(s) 111
BstSFI CTRYAG 1 cut(s) 375
BstV2I GAAGAC 2 cut(s) 46, 70
BsuI GTATCC 1 cut(s) 178
BtsCI GGATG 2 cut(s) 357, 424
BveI ACCTGC 1 cut(s) 382
Cfr13I GGNCC 1 cut(s) 88
CviAII CATG 4 cut(s) 83, 108, 155, 344
CviJI RGCY 4 cut(s) 30, 118, 146, 189
CviKI_1 RGCY 4 cut(s) 30, 118, 146, 189
DdeI CTNAG 2 cut(s) 132, 516
DpnI GATC 1 cut(s) 414
DpnII GATC 1 cut(s) 412
Eam1104I CTCTTC 1 cut(s) 450
EarI CTCTTC 1 cut(s) 450
Eco32I GATATC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 88
EcoRV GATATC 1 cut(s) 286
FaeI CATG 4 cut(s) 86, 111, 158, 347
FaiI YATR 7 cut(s) 39, 63, 84, 109, 156, 345, 366
FatI CATG 4 cut(s) 82, 107, 154, 343
FbaI TGATCA 1 cut(s) 412
FokI GGATG 2 cut(s) 344, 431
FspBI CTAG 2 cut(s) 50, 270
Hin1II CATG 4 cut(s) 86, 111, 158, 347
HinfI GANTC 4 cut(s) 7, 395, 482, 503
HphI GGTGA 2 cut(s) 280, 491
Hpy166II GTNNAC 2 cut(s) 44, 88
Hpy188I TCNGA 1 cut(s) 388
Hpy188III TCNNGA 4 cut(s) 131, 320, 416, 449
Hpy8I GTNNAC 2 cut(s) 44, 88
HpyAV CCTTC 1 cut(s) 134
HpyCH4V TGCA 4 cut(s) 19, 111, 184, 377
HpyF3I CTNAG 2 cut(s) 132, 516
Hsp92II CATG 4 cut(s) 86, 111, 158, 347
Ksp22I TGATCA 1 cut(s) 412
Kzo9I GATC 1 cut(s) 412
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 6 cut(s) 51, 87, 144, 211, 387, 401
MaeI CTAG 2 cut(s) 50, 270
MalI GATC 1 cut(s) 414
MboI GATC 1 cut(s) 412
MboII GAAGA 7 cut(s) 46, 70, 219, 419, 446, 452, 467
MluCI AATT 3 cut(s) 126, 352, 382
MnlI CCTC 5 cut(s) 208, 255, 457, 460, 506
MslI CAYNNNNRTG 1 cut(s) 159
NdeII GATC 1 cut(s) 412
NlaIII CATG 4 cut(s) 86, 111, 158, 347
NlaIV GGNNCC 1 cut(s) 312
NspI RCATGY 1 cut(s) 111
NspV TTCGAA 1 cut(s) 301
PfeI GAWTC 4 cut(s) 7, 395, 482, 503
PspN4I GGNNCC 1 cut(s) 312
PspPI GGNCC 1 cut(s) 88
PstI CTGCAG 1 cut(s) 379
RseI CAYNNNNRTG 1 cut(s) 159
Sau3AI GATC 1 cut(s) 412
Sau96I GGNCC 1 cut(s) 88
SetI ASST 4 cut(s) 93, 120, 148, 376
SfcI CTRYAG 1 cut(s) 375
SfuI TTCGAA 1 cut(s) 301
SinI GGWCC 1 cut(s) 88
SmiMI CAYNNNNRTG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 447
SmoI CTYRAG 1 cut(s) 447
Sse9I AATT 3 cut(s) 126, 352, 382
SspMI CTAG 2 cut(s) 50, 270
TaqI TCGA 1 cut(s) 301
TasI AATT 3 cut(s) 126, 352, 382
TfiI GAWTC 4 cut(s) 7, 395, 482, 503
TspDTI ATGAA 5 cut(s) 165, 420, 447, 453, 468
TspGWI ACGGA 1 cut(s) 47
VpaK11BI GGWCC 1 cut(s) 88
XceI RCATGY 1 cut(s) 111
XspI CTAG 2 cut(s) 50, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.