Rmu_sc0002892.1_g000039

response to hormone

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002892.1
Physical Location & Seq
Forward (+)
166023 .. 166274
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002892.1_g000039.1.cds

Sequence Viewer

Length: 252 bp
atgaatggaattttgaaagatgcctcatttgctatgcaagtcatggtgataggggtcaccaccgtggaagaacaaacgacccaaatagcccaattggctgaagcagttgagaagctacagaaaactattgaagagaaggatatggtaattactgcgctcatggagaggttagaaactcaacgtggcgatgactcagaaaaaggttcacatggtcataagaaagactcatctggcagatcattttctgaataa

Protein Analysis

83

Amino Acids

9.17

Weight (kDa)

4.98

Isoelectric Point (pI)

38.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 120
AgsI TTSAA 2 cut(s) 16, 131
AleI CACNNNNGTG 1 cut(s) 62
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
ApoI RAATTY 1 cut(s) 9
AspLEI GCGC 1 cut(s) 157
AsuHPI GGTGA 2 cut(s) 49, 58
BfmI CTRYAG 1 cut(s) 116
BglI GCCNNNNNGGC 1 cut(s) 95
BmsI GCATC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 207
Bsp143I GATC 1 cut(s) 236
BspCNI CTCAG 1 cut(s) 206
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 1 cut(s) 236
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 193
BstDSI CCRYGG 1 cut(s) 63
BstEII GGTNACC 1 cut(s) 55
BstHHI GCGC 1 cut(s) 157
BstKTI GATC 1 cut(s) 239
BstMBI GATC 1 cut(s) 236
BstMWI GCNNNNNNNGC 2 cut(s) 29, 95
BstPI GGTNACC 1 cut(s) 55
BstSFI CTRYAG 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 63
BtgZI GCGATG 1 cut(s) 201
CfoI GCGC 1 cut(s) 157
CviAII CATG 3 cut(s) 43, 160, 209
CviJI RGCY 3 cut(s) 89, 98, 115
CviKI_1 RGCY 3 cut(s) 89, 98, 115
DdeI CTNAG 1 cut(s) 193
DpnI GATC 1 cut(s) 238
DpnII GATC 1 cut(s) 236
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 120
Eco91I GGTNACC 1 cut(s) 55
EcoO65I GGTNACC 1 cut(s) 55
FaeI CATG 3 cut(s) 46, 163, 212
FaiI YATR 6 cut(s) 35, 44, 143, 161, 210, 216
FatI CATG 3 cut(s) 42, 159, 208
GlaI GCGC 1 cut(s) 156
HhaI GCGC 1 cut(s) 157
Hin1II CATG 3 cut(s) 46, 163, 212
Hin6I GCGC 1 cut(s) 155
HinP1I GCGC 1 cut(s) 155
HinfI GANTC 2 cut(s) 191, 224
HphI GGTGA 2 cut(s) 49, 58
Hpy166II GTNNAC 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 196, 247
Hpy8I GTNNAC 1 cut(s) 206
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4IV ACGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 95
HpyF3I CTNAG 1 cut(s) 193
HpySE526I ACGT 1 cut(s) 181
Hsp92II CATG 3 cut(s) 46, 163, 212
HspAI GCGC 1 cut(s) 155
Kzo9I GATC 1 cut(s) 236
LpnPI CCDG 1 cut(s) 216
LweI GCATC 1 cut(s) 10
MaeII ACGT 1 cut(s) 181
MaeIII GTNAC 1 cut(s) 55
MalI GATC 1 cut(s) 238
MboI GATC 1 cut(s) 236
MboII GAAGA 2 cut(s) 80, 143
MfeI CAATTG 1 cut(s) 92
MluCI AATT 3 cut(s) 9, 92, 147
MlyI GAGTC 2 cut(s) 185, 218
MnlI CCTC 2 cut(s) 34, 159
MslI CAYNNNNRTG 1 cut(s) 62
MunI CAATTG 1 cut(s) 92
MwoI GCNNNNNNNGC 2 cut(s) 29, 95
NdeII GATC 1 cut(s) 236
NlaIII CATG 3 cut(s) 46, 163, 212
NmuCI GTSAC 1 cut(s) 55
OliI CACNNNNGTG 1 cut(s) 62
PleI GAGTC 2 cut(s) 185, 218
PpsI GAGTC 2 cut(s) 185, 218
PspEI GGTNACC 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 62
Sau3AI GATC 1 cut(s) 236
SchI GAGTC 2 cut(s) 185, 218
SetI ASST 4 cut(s) 117, 170, 184, 205
SfaNI GCATC 1 cut(s) 10
SfcI CTRYAG 1 cut(s) 116
SgeI CNNG 7 cut(s) 50, 55, 76, 172, 194, 221, 243
SmiMI CAYNNNNRTG 1 cut(s) 62
Sse9I AATT 3 cut(s) 9, 92, 147
TaaI ACNGT 1 cut(s) 64
TaiI ACGT 1 cut(s) 184
TasI AATT 3 cut(s) 9, 92, 147
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.