Rh1AG405600

Carboxylesterase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0000860
Physical Location & Seq
Forward (+)
63321571 .. 63351922
30352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG405600.1

Sequence Viewer

Length: 480 bp
ATGCAGGACTATGTGTGGCTGCTGAGGGCGATAACGTTCGCCCACTCGTTGAAGATCGGAGGGCTGATATTGATCCAACCGTTGTTCGGTGGGTCCCGAAGGACTAGCTCGGAGTTGAGGCTAGGGAACGACCCTATTTTGGGGATTAGTGTATGTGATCTCATGTGGGACTTGTCGCTGCCTTTGGGGGTTGACCGTGATCACGAGTATTGCAATCCGATGGCGGGTGGCGATTCTAATGTATTTGATAAAGTGAAAGCACTTGGGTGGAGAGTTTTGTTCTCAAAATCTTGCTTGGCTTTTGAAGCCACAGATGGGCATGGAGGAAGAAGAACCCATATTCCTTTAGAGGCACAATCTAAGATAGATGGTGAGTTTATTTGGGCTGCTGCTGTTCACATTCAAGCCTCCGACGGGTTAGCCTCAACCATCACATCTCCGGCCGACATCTCAACACTCCTGGTATCAAAGATTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

159

Amino Acids

17.3

Weight (kDa)

5.9

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 16 - 78 9.4e-06 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 224
AclI AACGTT 1 cut(s) 35
AclWI GGATC 1 cut(s) 67
AcoI YGGCCR 1 cut(s) 441
AfiI CCNNNNNNNGG 6 cut(s) 86, 139, 140, 224, 315, 414
AgsI TTSAA 3 cut(s) 52, 305, 404
AjnI CCWGG 1 cut(s) 459
AleI CACNNNNGTG 1 cut(s) 265
AloI GAACNNNNNNTCC 2 cut(s) 325, 357
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AlwI GGATC 1 cut(s) 67
AoxI GGCC 1 cut(s) 441
ApeKI GCWGC 4 cut(s) 19, 178, 386, 389
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 383
AvaII GGWCC 1 cut(s) 93
BauI CACGAG 1 cut(s) 203
BbvCI CCTCAGC 1 cut(s) 23
BbvI GCAGC 4 cut(s) 6, 165, 373, 376
BccI CCATC 4 cut(s) 214, 308, 362, 437
BciT130I CCWGG 1 cut(s) 461
BclI TGATCA 1 cut(s) 199
BfaI CTAG 2 cut(s) 105, 122
BisI GCNGC 4 cut(s) 20, 179, 387, 390
BlsI GCNGC 4 cut(s) 21, 180, 388, 391
Bme1390I CCNGG 1 cut(s) 461
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BmiI GGNNCC 2 cut(s) 94, 95
BmrFI CCNGG 1 cut(s) 461
Bpu10I CCTNAGC 1 cut(s) 23
BsaBI GATNNNNATC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 6 cut(s) 86, 139, 140, 224, 315, 414
Bse8I GATNNNNATC 1 cut(s) 71
BseBI CCWGG 1 cut(s) 461
BseJI GATNNNNATC 1 cut(s) 71
BseLI CCNNNNNNNGG 6 cut(s) 86, 139, 140, 224, 315, 414
BseMII CTCAG 1 cut(s) 14
BseX3I CGGCCG 1 cut(s) 441
BseXI GCAGC 4 cut(s) 6, 165, 373, 376
Bsh1285I CGRYCG 1 cut(s) 444
BshFI GGCC 1 cut(s) 443
BsiEI CGRYCG 1 cut(s) 444
BsiSI CCGG 1 cut(s) 440
BslFI GGGAC 2 cut(s) 79, 182
BslI CCNNNNNNNGG 6 cut(s) 86, 139, 140, 224, 315, 414
BsmFI GGGAC 2 cut(s) 79, 182
BsnI GGCC 1 cut(s) 443
Bsp143I GATC 4 cut(s) 54, 72, 157, 199
BspACI CCGC 1 cut(s) 224
BspANI GGCC 1 cut(s) 443
BspCNI CTCAG 1 cut(s) 15
BspLI GGNNCC 2 cut(s) 94, 95
BspPI GGATC 1 cut(s) 67
BssMI GATC 4 cut(s) 54, 72, 157, 199
BssSI CACGAG 1 cut(s) 203
Bst2BI CACGAG 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 461
Bst4CI ACNGT 2 cut(s) 81, 197
BstDEI CTNAG 2 cut(s) 23, 360
BstKTI GATC 4 cut(s) 57, 75, 160, 202
BstMBI GATC 4 cut(s) 54, 72, 157, 199
BstMCI CGRYCG 1 cut(s) 444
BstMWI GCNNNNNNNGC 1 cut(s) 305
BstNI CCWGG 1 cut(s) 461
BstSCI CCNGG 1 cut(s) 459
BstV1I GCAGC 4 cut(s) 6, 165, 373, 376
BstZI CGGCCG 1 cut(s) 441
BsuRI GGCC 1 cut(s) 443
Cfr13I GGNCC 1 cut(s) 93
CviAII CATG 2 cut(s) 163, 320
DdeI CTNAG 2 cut(s) 23, 360
DpnI GATC 4 cut(s) 56, 74, 159, 201
DpnII GATC 4 cut(s) 54, 72, 157, 199
EaeI YGGCCR 1 cut(s) 441
EagI CGGCCG 1 cut(s) 441
EclXI CGGCCG 1 cut(s) 441
Eco47I GGWCC 1 cut(s) 93
Eco52I CGGCCG 1 cut(s) 441
EcoO109I RGGNCCY 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 459
FaeI CATG 2 cut(s) 166, 323
FaiI YATR 6 cut(s) 12, 154, 164, 321, 339, 476
FaqI GGGAC 2 cut(s) 79, 182
FatI CATG 2 cut(s) 162, 319
FauI CCCGC 1 cut(s) 217
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 4 cut(s) 20, 179, 387, 390
Fsp4HI GCNGC 4 cut(s) 20, 179, 387, 390
FspBI CTAG 2 cut(s) 105, 122
GluI GCNGC 4 cut(s) 20, 179, 387, 390
HaeIII GGCC 1 cut(s) 443
HapII CCGG 1 cut(s) 440
Hin1II CATG 2 cut(s) 166, 323
HincII GTYRAC 1 cut(s) 193
HindII GTYRAC 1 cut(s) 193
HinfI GANTC 1 cut(s) 233
HpaII CCGG 1 cut(s) 440
HphI GGTGA 1 cut(s) 383
Hpy166II GTNNAC 2 cut(s) 193, 397
Hpy188I TCNGA 4 cut(s) 59, 112, 219, 412
Hpy188III TCNNGA 2 cut(s) 96, 203
Hpy8I GTNNAC 2 cut(s) 193, 397
Hpy99I CGWCG 1 cut(s) 416
HpyAV CCTTC 1 cut(s) 93
HpyCH4III ACNGT 2 cut(s) 81, 197
HpyCH4IV ACGT 1 cut(s) 35
HpyCH4V TGCA 2 cut(s) 4, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 305
HpyF3I CTNAG 2 cut(s) 23, 360
HpySE526I ACGT 1 cut(s) 35
Hsp92II CATG 2 cut(s) 166, 323
KflI GGGWCCC 1 cut(s) 93
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 4 cut(s) 54, 72, 157, 199
LpnPI CCDG 3 cut(s) 446, 453, 473
Lsp1109I GCAGC 4 cut(s) 6, 165, 373, 376
MaeI CTAG 2 cut(s) 105, 122
MaeII ACGT 1 cut(s) 35
MalI GATC 4 cut(s) 56, 74, 159, 201
MboI GATC 4 cut(s) 54, 72, 157, 199
MboII GAAGA 3 cut(s) 64, 339, 342
MmeI TCCRAC 2 cut(s) 100, 435
MnlI CCTC 7 cut(s) 18, 53, 111, 317, 343, 418, 433
MslI CAYNNNNRTG 1 cut(s) 265
MspI CCGG 1 cut(s) 440
MspR9I CCNGG 1 cut(s) 461
MvaI CCWGG 1 cut(s) 461
MwoI GCNNNNNNNGC 1 cut(s) 305
NdeII GATC 4 cut(s) 54, 72, 157, 199
NlaIII CATG 2 cut(s) 166, 323
NlaIV GGNNCC 2 cut(s) 94, 95
OliI CACNNNNGTG 1 cut(s) 265
PfeI GAWTC 1 cut(s) 233
PkrI GCNGC 4 cut(s) 21, 180, 388, 391
PpuMI RGGWCCY 1 cut(s) 93
Psp1406I AACGTT 1 cut(s) 35
Psp5II RGGWCCY 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 459
PspGI CCWGG 1 cut(s) 459
PspN4I GGNNCC 2 cut(s) 94, 95
PspPI GGNCC 1 cut(s) 93
PspPPI RGGWCCY 1 cut(s) 93
RseI CAYNNNNRTG 1 cut(s) 265
SatI GCNGC 4 cut(s) 20, 179, 387, 390
Sau3AI GATC 4 cut(s) 54, 72, 157, 199
Sau96I GGNCC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 461
SetI ASST 2 cut(s) 38, 110
SinI GGWCC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 265
SsiI CCGC 1 cut(s) 224
SspMI CTAG 2 cut(s) 105, 122
StyD4I CCNGG 1 cut(s) 459
TaaI ACNGT 2 cut(s) 81, 197
TaiI ACGT 1 cut(s) 38
TfiI GAWTC 1 cut(s) 233
TseI GCWGC 4 cut(s) 19, 178, 386, 389
VpaK11BI GGWCC 1 cut(s) 93
XspI CTAG 2 cut(s) 105, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.