Rh5AG326600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
49197091 .. 49200942
3852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG326600.1

Sequence Viewer

Length: 318 bp
ATGCTCTATCTTATCTTCTCTGGGACTGGGGGTCTGATATCAAACCAGCGAAAAAACAAAACCCCATCTCGTCTCAGTCCAACACCACCACTCCTCCACAAGTTCTTTGTTTTGCCAAAACAAAATACTCCACAAGTAGACTTGATCTGCGCCTGCAAGCAACATCAGAAGTTCTATGCTGGTAAGTGTCACAGCACAGACGGACATGGAGGAAGAAGAACCCATATTCCTTTAGGGGCACAATCCAAGATAGATGGGAGTCAGGGACTATGTAACATAATTCAGGGACTCCATTACAGGGAGTCAGGGACTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.57

Weight (kDa)

9.84

Isoelectric Point (pI)

61.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 298
AhdI GACNNNNNGTC 1 cut(s) 30
AloI GAACNNNNNNTCC 2 cut(s) 211, 243
Alw26I GTCTC 1 cut(s) 77
AspLEI GCGC 1 cut(s) 152
BaeGI GKGCMC 1 cut(s) 241
BccI CCATC 2 cut(s) 73, 248
BcoDI GTCTC 1 cut(s) 77
BmeRI GACNNNNNGTC 1 cut(s) 30
BmrI ACTGGG 1 cut(s) 36
BmuI ACTGGG 1 cut(s) 36
BsaXI ACNNNNNCTCC 4 cut(s) 75, 78, 105, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 298
Bse1I ACTGG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 298
BseMII CTCAG 1 cut(s) 88
BseNI ACTGG 1 cut(s) 31
BseRI GAGGAG 1 cut(s) 83
BseSI GKGCMC 1 cut(s) 241
BslFI GGGAC 3 cut(s) 37, 279, 300
BslI CCNNNNNNNGG 1 cut(s) 298
BsmAI GTCTC 1 cut(s) 77
BsmBI CGTCTC 1 cut(s) 77
BsmFI GGGAC 3 cut(s) 37, 279, 300
Bsp1286I GDGCHC 1 cut(s) 241
Bsp143I GATC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 87
BsrI ACTGG 1 cut(s) 31
BssMI GATC 1 cut(s) 144
BstC8I GCNNGC 2 cut(s) 154, 158
BstDEI CTNAG 1 cut(s) 74
BstHHI GCGC 1 cut(s) 152
BstKTI GATC 1 cut(s) 147
BstMAI GTCTC 1 cut(s) 77
BstMBI GATC 1 cut(s) 144
BstSLI GKGCMC 1 cut(s) 241
Cac8I GCNNGC 2 cut(s) 154, 158
CfoI GCGC 1 cut(s) 152
CviAII CATG 1 cut(s) 206
DdeI CTNAG 1 cut(s) 74
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
DriI GACNNNNNGTC 1 cut(s) 30
Eam1105I GACNNNNNGTC 1 cut(s) 30
Eco32I GATATC 1 cut(s) 39
EcoRV GATATC 1 cut(s) 39
Esp3I CGTCTC 1 cut(s) 77
FaeI CATG 1 cut(s) 209
FaiI YATR 6 cut(s) 177, 207, 225, 271, 278, 314
FaqI GGGAC 3 cut(s) 37, 279, 300
FatI CATG 1 cut(s) 205
FblI GTMKAC 1 cut(s) 138
GlaI GCGC 1 cut(s) 151
HhaI GCGC 1 cut(s) 152
Hin1II CATG 1 cut(s) 209
Hin6I GCGC 1 cut(s) 150
HinP1I GCGC 1 cut(s) 150
HinfI GANTC 3 cut(s) 259, 288, 302
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 36, 168
Hpy8I GTNNAC 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 1 cut(s) 209
HspAI GCGC 1 cut(s) 150
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 9 cut(s) 6, 12, 59, 165, 166, 248, 269, 283, 291
MaeIII GTNAC 2 cut(s) 188, 272
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 3 cut(s) 7, 225, 228
MhlI GDGCHC 1 cut(s) 241
MluCI AATT 1 cut(s) 279
MlyI GAGTC 3 cut(s) 268, 282, 311
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 2 cut(s) 104, 203
NdeII GATC 1 cut(s) 144
NlaIII CATG 1 cut(s) 209
NmuCI GTSAC 1 cut(s) 188
PleI GAGTC 3 cut(s) 267, 282, 310
PpsI GAGTC 3 cut(s) 267, 282, 310
Sau3AI GATC 1 cut(s) 144
SchI GAGTC 3 cut(s) 268, 282, 311
SduI GDGCHC 1 cut(s) 241
Sse9I AATT 1 cut(s) 279
TasI AATT 1 cut(s) 279
TseFI GTSAC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 188
TspGWI ACGGA 1 cut(s) 216
XmiI GTMKAC 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.