Rh1AG413500

Carboxylesterase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0000860
Physical Location & Seq
Reverse (-)
64584222 .. 64584464
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG413500.1

Sequence Viewer

Length: 243 bp
ATGGCGGGTGGCGATTCTAATGGCTTTGATCAAGTGAAAGCACTTGGGTGGAAAGTTTTGGTGAGTGGCTCTGATGGAGACCCACTGATCGATCGTCAGATTGAGCTGGTGAAGATGTTGGAGGGAAAGGGTGTACATGTGGTGAGTCAGTTTATTGAAGGAGGTTATCATGGGGCTCAAGATGTTGAACCCTCCAAAGCCAGGGATGTGTTTGTGATTGTTAAGCATTTCATATTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

80

Amino Acids

8.67

Weight (kDa)

5.42

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AfaI GTAC 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 201
AflIII ACRYGT 1 cut(s) 136
AgsI TTSAA 2 cut(s) 158, 188
AjnI CCWGG 1 cut(s) 200
AleI CACNNNNGTG 1 cut(s) 46
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
Alw26I GTCTC 1 cut(s) 72
AsuHPI GGTGA 3 cut(s) 73, 121, 154
BanII GRGCYC 1 cut(s) 178
BccI CCATC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 202
BclI TGATCA 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 202
BpuEI CTTGAG 1 cut(s) 162
Bsa29I ATCGAT 1 cut(s) 90
BsaI GGTCTC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 202
BseCI ATCGAT 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 201
Bsh1285I CGRYCG 1 cut(s) 94
BshVI ATCGAT 1 cut(s) 90
BsiEI CGRYCG 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 201
BsmAI GTCTC 1 cut(s) 72
Bso31I GGTCTC 1 cut(s) 72
Bsp1286I GDGCHC 1 cut(s) 178
Bsp1407I TGTACA 1 cut(s) 133
Bsp143I GATC 3 cut(s) 28, 87, 91
BspACI CCGC 1 cut(s) 5
BspDI ATCGAT 1 cut(s) 90
BspTNI GGTCTC 1 cut(s) 72
BsrGI TGTACA 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 3 cut(s) 28, 87, 91
Bst2UI CCWGG 1 cut(s) 202
BstAUI TGTACA 1 cut(s) 133
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 3 cut(s) 31, 90, 94
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 3 cut(s) 28, 87, 91
BstMCI CGRYCG 1 cut(s) 94
BstNI CCWGG 1 cut(s) 202
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 200
Bsu15I ATCGAT 1 cut(s) 90
BsuTUI ATCGAT 1 cut(s) 90
BtsCI GGATG 1 cut(s) 211
BtsIMutI CAGTG 1 cut(s) 83
ClaI ATCGAT 1 cut(s) 90
Csp6I GTAC 1 cut(s) 134
CviAII CATG 2 cut(s) 137, 170
CviJI RGCY 5 cut(s) 24, 69, 106, 176, 200
CviKI_1 RGCY 5 cut(s) 24, 69, 106, 176, 200
CviQI GTAC 1 cut(s) 134
DpnI GATC 3 cut(s) 30, 89, 93
DpnII GATC 3 cut(s) 28, 87, 91
Eco24I GRGCYC 1 cut(s) 178
Eco31I GGTCTC 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 200
EcoT38I GRGCYC 1 cut(s) 178
FaeI CATG 2 cut(s) 140, 173
FaiI YATR 3 cut(s) 138, 171, 233
FatI CATG 2 cut(s) 136, 169
FbaI TGATCA 1 cut(s) 28
FokI GGATG 1 cut(s) 218
FriOI GRGCYC 1 cut(s) 178
Hin1II CATG 2 cut(s) 140, 173
HinfI GANTC 2 cut(s) 14, 145
HphI GGTGA 3 cut(s) 73, 121, 154
Hpy166II GTNNAC 1 cut(s) 134
Hpy188I TCNGA 2 cut(s) 73, 99
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 152
Hsp92II CATG 2 cut(s) 140, 173
Ksp22I TGATCA 1 cut(s) 28
Kzo9I GATC 3 cut(s) 28, 87, 91
LpnPI CCDG 3 cut(s) 92, 187, 214
MalI GATC 3 cut(s) 30, 89, 93
MboI GATC 3 cut(s) 28, 87, 91
MboII GAAGA 1 cut(s) 124
MhlI GDGCHC 1 cut(s) 178
MlyI GAGTC 1 cut(s) 154
MmeI TCCRAC 1 cut(s) 99
MnlI CCTC 3 cut(s) 115, 155, 202
MseI TTAA 2 cut(s) 222, 241
MslI CAYNNNNRTG 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 202
MvaI CCWGG 1 cut(s) 202
NdeII GATC 3 cut(s) 28, 87, 91
NlaIII CATG 2 cut(s) 140, 173
NspI RCATGY 1 cut(s) 140
OliI CACNNNNGTG 1 cut(s) 46
PciI ACATGT 1 cut(s) 136
PfeI GAWTC 1 cut(s) 14
Ple19I CGATCG 1 cut(s) 94
PleI GAGTC 1 cut(s) 153
PpsI GAGTC 1 cut(s) 153
PscI ACATGT 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 200
PspGI CCWGG 1 cut(s) 200
PvuI CGATCG 1 cut(s) 94
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 46
SaqAI TTAA 2 cut(s) 222, 241
Sau3AI GATC 3 cut(s) 28, 87, 91
SchI GAGTC 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 202
SduI GDGCHC 1 cut(s) 178
SetI ASST 2 cut(s) 108, 166
SgeI CNNG 9 cut(s) 18, 44, 56, 119, 149, 182, 191, 213, 214
SmiMI CAYNNNNRTG 1 cut(s) 46
SmlI CTYRAG 1 cut(s) 177
SmoI CTYRAG 1 cut(s) 177
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 200
TaqI TCGA 1 cut(s) 90
TatI WGTACW 1 cut(s) 133
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 2 cut(s) 222, 241
Tru9I TTAA 2 cut(s) 222, 241
TscAI CASTG 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 220
TspRI CASTG 1 cut(s) 90
XceI RCATGY 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.