Rh5BG335300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
46715158 .. 46715838
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG335300.1

Sequence Viewer

Length: 273 bp
ATGTGGAATGGCTTGATGGCGTCATCTCAAAAAGTTTTATCGCTAGTTGCTGAGTTGAAAACACTTCAGAAGAATAATGAAACACTTGAGAAGGATGAAGAACATCTAAGGACCAATCTTCTTTCTGCTGAAGAGGAGGTCAAATTGCTTGTCGAAGAAAACAAGGTGTTAGATGAAGCTAACAAAAGATTACTAAAGCAGTACCGCAAGGAAAGAAACAATTCTGGTTCTGATGGAAAGCATACTGATGTATCAACGAAGTCAAACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.32

Weight (kDa)

6.74

Isoelectric Point (pI)

38.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000497)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14680 AT4G09060 AT4G09060
fragaria_vesca FvH4_5g36300 FvH4_5g36300
malus_domestica MD08G1189700.v1.1 MD08G1190000.v1.1 MD08G1190200.v1.1 MD15G1377500.v1.1
prunus_persica Prupe.1G524200_v2.0.a1
pyrus_communis pycom08g16320 pycom15g33820
rosa_chinensis RchiOBHm_Chr3g0481851 RchiOBHm_Chr3g0481861 RchiOBHm_Chr5g0040961 RchiOBHm_Chr5g0044491 RchiOBHm_Chr5g0044811 RchiOBHm_Chr5g0045611 RchiOBHm_Chr5g0045621 RchiOBHm_Chr5g0049341 RchiOBHm_Chr5g0049351 RchiOBHm_Chr7g0238301 RchiOBHm_Chr7g0238321
rosa_laevigata RLG00000000918 RLG00000000921 RLG00000034299 RLG00000034300
rosa_multiflora Rmu_sc0001047.1_g000051 Rmu_sc0001371.1_g000020 Rmu_sc0001847.1_g000002 Rmu_sc0002988.1_g000004 Rmu_sc0003789.1_g000001 Rmu_sc0004567.1_g000016 Rmu_sc0004800.1_g000003 Rmu_sc0005102.1_g000001 Rmu_sc0006651.1_g000010 Rmu_sc0006651.1_g000011 Rmu_ssc0000398.1_g000017
rosa_roxburghii Rroxscaffold_153G00436700 Rroxscaffold_153G00436710 Rroxscaffold_1G00034810 Rroxscaffold_1G00036220 Rroxscaffold_1G00036230 Rroxscaffold_1G00074790 Rroxscaffold_2G00104790 Rroxscaffold_2G00104800 Rroxscaffold_3G00223120 Rroxscaffold_5G00337240 Rroxscaffold_6G00399830 Rroxscaffold_6G00400170
rosa_rugosa Rorug02G0148000 Rorug04G0003000 Rorug05G0218300 Rorug05G0218400 Rorug05G0219900 Rorug07G0311100 Rorug07G0311900
rosa_samantha Rh2BG555200 Rh3DG293700 Rh4BG116500 Rh5BG279700 Rh5BG308000 Rh5BG308100 Rh5BG313100 Rh5BG313200 Rh5BG335300 Rh5BG335400 Rh5CG335000 Rh5CG335100 Rh5DG287700 Rh5DG318100 Rh5DG318200 Rh5DG323600 Rh5DG323700 Rh5DG347600 Rh5DG347700 Rh6DG317800 Rh7BG437500 Rh7CG484600 Rh7DG453000
rosa_wichuraiana Rw0G004340 Rw5G025810 Rw5G027210 Rw5G027900 Rw5G028300 Rw5G030640 Rw7G038670 Rw7G038780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 205
AcuI CTGAAG 2 cut(s) 50, 150
AcyI GRCGYC 1 cut(s) 20
AfaI GTAC 1 cut(s) 203
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
ArsI GACNNNNNNTTYG 2 cut(s) 135, 167
Asp700I GAANNNNTTC 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 111
AvaII GGWCC 1 cut(s) 111
BaeI ACNNNNGTAYC 2 cut(s) 234, 267
BccI CCATC 2 cut(s) 10, 227
BfaI CTAG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 111
BmgT120I GGNCC 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 107
BsaHI GRCGYC 1 cut(s) 20
BseGI GGATG 1 cut(s) 100
BseMII CTCAG 1 cut(s) 42
BseRI GAGGAG 1 cut(s) 149
BspACI CCGC 1 cut(s) 205
BspCNI CTCAG 1 cut(s) 43
BssNI GRCGYC 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 126
BstACI GRCGYC 1 cut(s) 20
BstDEI CTNAG 2 cut(s) 51, 107
BstF5I GGATG 1 cut(s) 100
BtsCI GGATG 1 cut(s) 100
Cfr13I GGNCC 1 cut(s) 111
CseI GACGC 1 cut(s) 9
Csp6I GTAC 1 cut(s) 202
CviJI RGCY 2 cut(s) 12, 179
CviKI_1 RGCY 2 cut(s) 12, 179
CviQI GTAC 1 cut(s) 202
DdeI CTNAG 2 cut(s) 51, 107
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 111
Eco57I CTGAAG 2 cut(s) 50, 150
FaiI YATR 1 cut(s) 243
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 44
HgaI GACGC 1 cut(s) 9
Hin1I GRCGYC 1 cut(s) 20
Hpy188I TCNGA 2 cut(s) 69, 232
HpyAV CCTTC 1 cut(s) 85
HpyF3I CTNAG 2 cut(s) 51, 107
Hsp92I GRCGYC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 210
MaeI CTAG 1 cut(s) 44
MboII GAAGA 5 cut(s) 82, 110, 110, 143, 167
MluCI AATT 2 cut(s) 143, 220
MnlI CCTC 2 cut(s) 127, 130
MroXI GAANNNNTTC 1 cut(s) 220
MslI CAYNNNNRTG 1 cut(s) 246
PdmI GAANNNNTTC 1 cut(s) 220
PspPI GGNCC 1 cut(s) 111
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
RseI CAYNNNNRTG 1 cut(s) 246
Sau96I GGNCC 1 cut(s) 111
SetI ASST 3 cut(s) 141, 168, 181
SgeI CNNG 7 cut(s) 25, 56, 98, 161, 175, 220, 237
SinI GGWCC 1 cut(s) 111
SmiMI CAYNNNNRTG 1 cut(s) 246
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 2 cut(s) 143, 220
SsiI CCGC 1 cut(s) 205
SspMI CTAG 1 cut(s) 44
TaqI TCGA 1 cut(s) 153
TasI AATT 2 cut(s) 143, 220
TspDTI ATGAA 3 cut(s) 93, 111, 189
VpaK11BI GGWCC 1 cut(s) 111
XmnI GAANNNNTTC 1 cut(s) 220
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.