Prupe.1G102800_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0001043
Physical Location & Seq
Forward (+)
8212786 .. 8213570
785 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G102800.1

Sequence Viewer

Length: 243 bp
ATGATTGACCTACCTATGTTTTGGCTAGTCATTGTCAGTTTACCCGTGATGAAAGAGAATAATCATAAGTGTTCAAGAGTGGTTCGACATTCAAAATATCTCTTTGTTTGGAAAGGAAGAATTCAGTTTTCTCATGGAGTCTTTGGTGATGACGATCTAGACTTGAGGACGAGACTTTTCCAACCAGGGGAGTTTGATGCAGGAGCATCTACAAGGCTCTTTAAAAGTACTTGGGTCCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.41

Weight (kDa)

9.43

Isoelectric Point (pI)

20.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 120
AfaI GTAC 1 cut(s) 229
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 2 cut(s) 75, 93
AjnI CCWGG 1 cut(s) 184
Alw26I GTCTC 1 cut(s) 166
ApoI RAATTY 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 1 cut(s) 158
AvaII GGWCC 1 cut(s) 235
BciT130I CCWGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 2 cut(s) 26, 158
BmcAI AGTACT 1 cut(s) 229
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 187, 215
BpuEI CTTGAG 1 cut(s) 184
BsaBI GATNNNNATC 1 cut(s) 153
BsaJI CCNNGG 1 cut(s) 185
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse8I GATNNNNATC 1 cut(s) 153
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 185
BseJI GATNNNNATC 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 187
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 185
BssMI GATC 1 cut(s) 154
Bst2UI CCWGG 1 cut(s) 186
BstKTI GATC 1 cut(s) 157
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 1 cut(s) 154
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 228
CviAII CATG 1 cut(s) 134
CviJI RGCY 2 cut(s) 25, 217
CviKI_1 RGCY 2 cut(s) 25, 217
CviQI GTAC 1 cut(s) 228
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
DraI TTTAAA 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 235
EcoRI GAATTC 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 1 cut(s) 137
FaiI YATR 3 cut(s) 17, 66, 135
FatI CATG 1 cut(s) 133
FspBI CTAG 2 cut(s) 26, 158
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 138
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 41
Hpy188III TCNNGA 2 cut(s) 75, 158
Hpy8I GTNNAC 1 cut(s) 41
HpyCH4V TGCA 1 cut(s) 200
Hsp92II CATG 1 cut(s) 137
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 203
LpnPI CCDG 3 cut(s) 171, 186, 198
LweI GCATC 2 cut(s) 187, 215
MaeI CTAG 2 cut(s) 26, 158
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 1 cut(s) 129
MluCI AATT 1 cut(s) 120
MlyI GAGTC 1 cut(s) 147
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 1 cut(s) 159
MseI TTAA 1 cut(s) 222
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 1 cut(s) 236
PleI GAGTC 1 cut(s) 146
PpsI GAGTC 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 236
PspPI GGNCC 1 cut(s) 235
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
SaqAI TTAA 1 cut(s) 222
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 235
ScaI AGTACT 1 cut(s) 229
SchI GAGTC 1 cut(s) 147
ScrFI CCNGG 1 cut(s) 186
SetI ASST 2 cut(s) 12, 16
SfaNI GCATC 2 cut(s) 187, 215
SinI GGWCC 1 cut(s) 235
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
Sse9I AATT 1 cut(s) 120
SspMI CTAG 2 cut(s) 26, 158
StyD4I CCNGG 1 cut(s) 184
TaqI TCGA 1 cut(s) 85
TasI AATT 1 cut(s) 120
TatI WGTACW 1 cut(s) 227
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TspDTI ATGAA 1 cut(s) 65
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 1 cut(s) 120
XbaI TCTAGA 1 cut(s) 157
XspI CTAG 2 cut(s) 26, 158
ZrmI AGTACT 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.