Rroxscaffold_2G00131280

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001043
Physical Location & Seq
Forward (+)
67832690 .. 67833935
1246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00131280.1

Sequence Viewer

Length: 381 bp
ATGGACATGGGTAGCAATATTATTGATAAAGAGTTTGAGCTAGTAGGAGGAAAAATTACTATCCACATGCAAGAAATTGATCCAAATATCCAAGTCATTGAAACTACTGTACCAACAATTGAAGTGGAAGACATTTACTCGTGTATGAGTATTGACGAACTTGATATGGGTGAGAGGATTGATGATATGAACTCAAACCATGGTCATATTGGTGATGCCAACGTGGATTTCAATTTTGGACTTCCAAGAACTAGGCATGAGCAAGGTTCAATCTTGGATGAGATTGGAGATGCTGTTTATGATGCCAGGAGAATACGATGGAAGAGGAACCACTGCCAAATTGCCCCATCATTACCTCAAGGTAGTAGAGATAGTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.23

Weight (kDa)

4.53

Isoelectric Point (pI)

66.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 4 cut(s) 101, 122, 232, 270
AjnI CCWGG 1 cut(s) 305
AjuI GAANNNNNNNTTGG 2 cut(s) 212, 244
AluBI AGCT 2 cut(s) 40, 378
AluI AGCT 2 cut(s) 40, 378
AlwI GGATC 1 cut(s) 74
AsuHPI GGTGA 2 cut(s) 182, 224
BaeI ACNNNNGTAYC 2 cut(s) 93, 126
BauI CACGAG 1 cut(s) 139
BbsI GAAGAC 1 cut(s) 135
BccI CCATC 2 cut(s) 312, 355
BciT130I CCWGG 1 cut(s) 307
BfaI CTAG 3 cut(s) 41, 252, 379
Bme1390I CCNGG 1 cut(s) 307
BmiI GGNNCC 1 cut(s) 329
BmrFI CCNGG 1 cut(s) 307
BmsI GCATC 3 cut(s) 205, 280, 292
BpiI GAAGAC 1 cut(s) 135
BpuEI CTTGAG 1 cut(s) 342
BsaJI CCNNGG 1 cut(s) 199
BsaXI ACNNNNNCTCC 2 cut(s) 279, 309
BseBI CCWGG 1 cut(s) 307
BseDI CCNNGG 1 cut(s) 199
BseGI GGATG 1 cut(s) 283
Bsp143I GATC 1 cut(s) 79
Bsp19I CCATGG 1 cut(s) 199
BspLI GGNNCC 1 cut(s) 329
BspPI GGATC 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 1 cut(s) 79
BssSI CACGAG 1 cut(s) 139
BssT1I CCWWGG 1 cut(s) 199
Bst2BI CACGAG 1 cut(s) 139
Bst2UI CCWGG 1 cut(s) 307
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 317
BstDSI CCRYGG 1 cut(s) 199
BstF5I GGATG 1 cut(s) 283
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 307
BstNSI RCATGY 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 305
BstV2I GAAGAC 1 cut(s) 135
BtgI CCRYGG 1 cut(s) 199
BtsCI GGATG 1 cut(s) 283
BtsI GCAGTG 1 cut(s) 331
BtsIMutI CAGTG 1 cut(s) 331
Csp6I GTAC 1 cut(s) 110
CspCI CAANNNNNGTGG 2 cut(s) 105, 140
CviAII CATG 4 cut(s) 7, 67, 200, 257
CviJI RGCY 2 cut(s) 40, 378
CviKI_1 RGCY 2 cut(s) 40, 378
CviQI GTAC 1 cut(s) 110
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 317
EarI CTCTTC 1 cut(s) 317
Eco130I CCWWGG 1 cut(s) 199
EcoRII CCWGG 1 cut(s) 305
EcoT14I CCWWGG 1 cut(s) 199
ErhI CCWWGG 1 cut(s) 199
FaeI CATG 4 cut(s) 10, 70, 203, 260
FaiI YATR 9 cut(s) 8, 68, 146, 167, 188, 201, 207, 258, 300
FatI CATG 4 cut(s) 6, 66, 199, 256
FokI GGATG 1 cut(s) 290
FspBI CTAG 3 cut(s) 41, 252, 379
Hin1II CATG 4 cut(s) 10, 70, 203, 260
HphI GGTGA 2 cut(s) 182, 224
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 222
HpyCH4V TGCA 1 cut(s) 70
HpySE526I ACGT 1 cut(s) 222
Hsp92II CATG 4 cut(s) 10, 70, 203, 260
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 292, 319
LweI GCATC 3 cut(s) 205, 280, 292
MaeI CTAG 3 cut(s) 41, 252, 379
MaeII ACGT 1 cut(s) 222
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 140, 334
MfeI CAATTG 1 cut(s) 117
MluCI AATT 5 cut(s) 54, 75, 117, 232, 339
MnlI CCTC 4 cut(s) 41, 168, 318, 366
MslI CAYNNNNRTG 1 cut(s) 210
MspR9I CCNGG 1 cut(s) 307
MunI CAATTG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 307
NcoI CCATGG 1 cut(s) 199
NdeII GATC 1 cut(s) 79
NlaIII CATG 4 cut(s) 10, 70, 203, 260
NlaIV GGNNCC 1 cut(s) 329
NspI RCATGY 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 305
PspGI CCWGG 1 cut(s) 305
PspN4I GGNNCC 1 cut(s) 329
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
RseI CAYNNNNRTG 1 cut(s) 210
Sau3AI GATC 1 cut(s) 79
ScrFI CCNGG 1 cut(s) 307
SetI ASST 6 cut(s) 42, 225, 268, 358, 364, 380
SfaNI GCATC 3 cut(s) 205, 280, 292
SmiMI CAYNNNNRTG 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 357
SmoI CTYRAG 1 cut(s) 357
Sse9I AATT 5 cut(s) 54, 75, 117, 232, 339
SspI AATATT 1 cut(s) 19
SspMI CTAG 3 cut(s) 41, 252, 379
StyD4I CCNGG 1 cut(s) 305
StyI CCWWGG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 109
TaiI ACGT 1 cut(s) 225
TasI AATT 5 cut(s) 54, 75, 117, 232, 339
TscAI CASTG 1 cut(s) 338
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 338
XceI RCATGY 1 cut(s) 70
XcmI CCANNNNNNNNNTGG 1 cut(s) 206
XspI CTAG 3 cut(s) 41, 252, 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.