Rh3CG303300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0001043
Physical Location & Seq
Forward (+)
31536952 .. 31537119
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG303300.1

Sequence Viewer

Length: 168 bp
ATGCCTGGTCAGGAAGCTGAACCTGTTGATGAATTAGCTCAAGGGAATGCAGAAGCTGTTGGTACACTGGTAACTGTTGATATATTGGAGGCTAGTGCTATGGAGGAAGTGGCTGAAGGGGGTGACATTTTGCTTTTGGAAAATGCATCCTCTTCAGCAAATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

5.53

Weight (kDa)

4.05

Isoelectric Point (pI)

38.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 135, 138
AfaI GTAC 1 cut(s) 64
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 3 cut(s) 17, 38, 56
AluI AGCT 3 cut(s) 17, 38, 56
AlwNI CAGNNNCTG 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 134
BaeI ACNNNNGTAYC 2 cut(s) 54, 87
BciT130I CCWGG 1 cut(s) 6
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BmsI GCATC 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 6
BseGI GGATG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 72
BsmI GAATGC 1 cut(s) 52
BsrI ACTGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 76
Bst6I CTCTTC 1 cut(s) 157
BstF5I GGATG 1 cut(s) 146
BstNI CCWGG 1 cut(s) 6
BstSCI CCNGG 1 cut(s) 4
BtsCI GGATG 1 cut(s) 146
BtsIMutI CAGTG 1 cut(s) 65
CaiI CAGNNNCTG 1 cut(s) 56
Csp6I GTAC 1 cut(s) 63
CviJI RGCY 5 cut(s) 17, 38, 56, 92, 113
CviKI_1 RGCY 5 cut(s) 17, 38, 56, 92, 113
CviQI GTAC 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 157
EarI CTCTTC 1 cut(s) 157
Eco57I CTGAAG 2 cut(s) 135, 138
EcoRII CCWGG 1 cut(s) 4
EcoT22I ATGCAT 1 cut(s) 148
FaiI YATR 2 cut(s) 83, 101
FokI GGATG 1 cut(s) 133
FspBI CTAG 1 cut(s) 93
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 50, 146
LpnPI CCDG 3 cut(s) 18, 36, 53
LweI GCATC 1 cut(s) 155
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 2 cut(s) 70, 122
MboII GAAGA 1 cut(s) 144
MluCI AATT 1 cut(s) 32
MnlI CCTC 3 cut(s) 82, 97, 160
Mph1103I ATGCAT 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 6
Mva1269I GAATGC 1 cut(s) 52
MvaI CCWGG 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 122
NsiI ATGCAT 1 cut(s) 148
PctI GAATGC 1 cut(s) 52
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
PstNI CAGNNNCTG 1 cut(s) 56
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
ScrFI CCNGG 1 cut(s) 6
SetI ASST 4 cut(s) 19, 25, 40, 58
SfaNI GCATC 1 cut(s) 155
SgeI CNNG 7 cut(s) 17, 18, 23, 35, 53, 80, 105
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
Sse9I AATT 1 cut(s) 32
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 4
TaaI ACNGT 1 cut(s) 76
TasI AATT 1 cut(s) 32
TscAI CASTG 1 cut(s) 72
TseFI GTSAC 1 cut(s) 122
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 45
TspRI CASTG 1 cut(s) 72
XspI CTAG 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.