Rroxscaffold_3G00229800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001043
Physical Location & Seq
Forward (+)
14358763 .. 14363072
4310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00229800.1

Sequence Viewer

Length: 213 bp
ATGAATGAGTTCACAAATGGTACTACTTCTGCTCTGATCACAACAGATGTTTGGGTCGGGGCCTTGATGTTCAACATGCAAGATAGTGAGAAAAATTTTGGGTTTGCAAAGTTAATGTTGGAGAGAAAATTTATGGAGTCAAAATCAAGGCATTTATTCCAAGTATCTAAATTTGGAAAGGAAGAATTCAATTGTAAGTTAAAGGTTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.15

Weight (kDa)

8.89

Isoelectric Point (pI)

11.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 94, 128, 170, 185
AfaI GTAC 1 cut(s) 22
AgsI TTSAA 3 cut(s) 73, 190, 209
AoxI GGCC 1 cut(s) 60
ApoI RAATTY 4 cut(s) 94, 128, 170, 185
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 60
BclI TGATCA 1 cut(s) 36
BmgT120I GGNCC 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 61
BshFI GGCC 1 cut(s) 62
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 36
BspANI GGCC 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 61
BssMI GATC 1 cut(s) 36
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstNSI RCATGY 1 cut(s) 79
BsuRI GGCC 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 21
CviAII CATG 1 cut(s) 76
CviJI RGCY 1 cut(s) 62
CviKI_1 RGCY 1 cut(s) 62
CviQI GTAC 1 cut(s) 21
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
EcoO109I RGGNCCY 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 185
FaeI CATG 1 cut(s) 79
FaiI YATR 2 cut(s) 77, 134
FatI CATG 1 cut(s) 75
FbaI TGATCA 1 cut(s) 36
HaeIII GGCC 1 cut(s) 62
Hin1II CATG 1 cut(s) 79
HinfI GANTC 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 36
Hpy8I GTNNAC 1 cut(s) 12
HpyCH4V TGCA 2 cut(s) 79, 107
Hsp92II CATG 1 cut(s) 79
Ksp22I TGATCA 1 cut(s) 36
Kzo9I GATC 1 cut(s) 36
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 1 cut(s) 194
MfeI CAATTG 1 cut(s) 190
MluCI AATT 5 cut(s) 94, 128, 170, 185, 190
MlyI GAGTC 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 99
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 2 cut(s) 113, 200
MunI CAATTG 1 cut(s) 190
NdeII GATC 1 cut(s) 36
NlaIII CATG 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 61
NspI RCATGY 1 cut(s) 79
PdmI GAANNNNTTC 1 cut(s) 8
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 60
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
SaqAI TTAA 2 cut(s) 113, 200
Sau3AI GATC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 60
SchI GAGTC 1 cut(s) 146
SetI ASST 1 cut(s) 207
SgeI CNNG 6 cut(s) 70, 76, 88, 92, 159, 173
Sse9I AATT 5 cut(s) 94, 128, 170, 185, 190
TasI AATT 5 cut(s) 94, 128, 170, 185, 190
Tru1I TTAA 2 cut(s) 113, 200
Tru9I TTAA 2 cut(s) 113, 200
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 4 cut(s) 94, 128, 170, 185
XceI RCATGY 1 cut(s) 79
XmnI GAANNNNTTC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.