Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7C

Orthogroup ID

OG0001043

Physical Location & Seq

Genomic Coordinates Reverse (-)

68477840 .. 68478091

Gene Structure 252 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7CG506000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

ATGAGTTTTGATAAACCACCGAAGTATGATTGTTATGAAGATTCTGAAGTTTGTGATGGTGGTGTGGAGGACCAAAGGAAAAATGATTGTGTTCTAATTGCTAGAAATTGTGATGAGTCCTCTAGTAAAAATAGCAAAGAACTTGACATTGGAAAACAACTTGAAGGAGAAGATGAAAATTTTTTGTATCGGATAAAATGTTTACCACTGCCTTTGTTAGTTCTCTTCGTGAAGCTATTGATCCAAAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

83

Amino Acids

9.52

Weight (kDa)

4.53

Isoelectric Point (pI)

45.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001043)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g07634
prunus_persica	Prupe.1G102800_v2.0.a1 Prupe.8G086900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0246931
rosa_laevigata	RLG00000003129 RLG00000005865 RLG00000005867 RLG00000008042 RLG00000017998 RLG00000019187 RLG00000019483 RLG00000022446 RLG00000023139 RLG00000032380 RLG00000034989 RLG00000037076
rosa_multiflora	Rmu_co8397459.1_g000001 Rmu_sc0000195.1_g000037 Rmu_sc0000516.1_g000018 Rmu_sc0001091.1_g000004 Rmu_sc0001113.1_g000012 Rmu_sc0001673.1_g000033 Rmu_sc0001694.1_g000016 Rmu_sc0001793.1_g000051 Rmu_sc0002676.1_g000007 Rmu_sc0002986.1_g000020 Rmu_sc0004253.1_g000001 Rmu_sc0004478.1_g000012 Rmu_sc0004614.1_g000007 Rmu_sc0005387.1_g000002 Rmu_sc0006592.1_g000013 Rmu_sc0006967.1_g000011 Rmu_sc0011039.1_g000002 Rmu_sc0016880.1_g000004 Rmu_ssc0000182.1_g000020
rosa_roxburghii	Rroxscaffold_1G00024880 Rroxscaffold_1G00053230 Rroxscaffold_1G00068810 Rroxscaffold_1G00068820 Rroxscaffold_2G00094300 Rroxscaffold_2G00095320 Rroxscaffold_2G00095330 Rroxscaffold_2G00108180 Rroxscaffold_2G00130520 Rroxscaffold_2G00131280 Rroxscaffold_3G00229800 Rroxscaffold_4G00279060 Rroxscaffold_4G00312500 Rroxscaffold_4G00312510 Rroxscaffold_7G00215840
rosa_samantha	Rh1BG408300 Rh3AG269100 Rh3CG198400 Rh3CG303300 Rh5AG056400 Rh5DG052900 Rh5DG388100 Rh7BG462700 Rh7CG506000
rosa_wichuraiana	Rw1G013080 Rw2G016330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	235
AcsI	RAATTY	1 cut(s)	178
AcuI	CTGAAG	1 cut(s)	66
AgsI	TTSAA	1 cut(s)	164
AjuI	GAANNNNNNNTTGG	2 cut(s)	132, 164
AluBI	AGCT	1 cut(s)	235
AluI	AGCT	1 cut(s)	235
AlwI	GGATC	1 cut(s)	235
ApoI	RAATTY	1 cut(s)	178
AspS9I	GGNCC	1 cut(s)	70
AvaII	GGWCC	1 cut(s)	70
BccI	CCATC	1 cut(s)	50
BfaI	CTAG	2 cut(s)	102, 123
Bme18I	GGWCC	1 cut(s)	70
BmgT120I	GGNCC	1 cut(s)	70
Bsp143I	GATC	1 cut(s)	240
BspPI	GGATC	1 cut(s)	235
BssMI	GATC	1 cut(s)	240
Bst6I	CTCTTC	1 cut(s)	230
BstKTI	GATC	1 cut(s)	243
BstMBI	GATC	1 cut(s)	240
BtsI	GCAGTG	1 cut(s)	206
BtsIMutI	CAGTG	1 cut(s)	206
Cfr13I	GGNCC	1 cut(s)	70
CspCI	CAANNNNNGTGG	2 cut(s)	195, 230
CviJI	RGCY	1 cut(s)	235
CviKI_1	RGCY	1 cut(s)	235
DpnI	GATC	1 cut(s)	242
DpnII	GATC	1 cut(s)	240
Eam1104I	CTCTTC	1 cut(s)	230
EarI	CTCTTC	1 cut(s)	230
Eco47I	GGWCC	1 cut(s)	70
Eco57I	CTGAAG	1 cut(s)	66
FaiI	YATR	2 cut(s)	27, 36
FspBI	CTAG	2 cut(s)	102, 123
HinfI	GANTC	2 cut(s)	41, 116
Hpy166II	GTNNAC	1 cut(s)	203
Hpy188I	TCNGA	2 cut(s)	46, 192
Hpy188III	TCNNGA	1 cut(s)	229
Hpy8I	GTNNAC	1 cut(s)	203
HpyAV	CCTTC	1 cut(s)	158
Kzo9I	GATC	1 cut(s)	240
MaeI	CTAG	2 cut(s)	102, 123
MalI	GATC	1 cut(s)	242
MboI	GATC	1 cut(s)	240
MboII	GAAGA	3 cut(s)	50, 182, 217
MluCI	AATT	4 cut(s)	96, 106, 178, 247
MlyI	GAGTC	1 cut(s)	125
MnlI	CCTC	2 cut(s)	61, 130
NdeII	GATC	1 cut(s)	240
PfeI	GAWTC	1 cut(s)	41
PleI	GAGTC	1 cut(s)	124
PpsI	GAGTC	1 cut(s)	124
PspPI	GGNCC	1 cut(s)	70
Sau3AI	GATC	1 cut(s)	240
Sau96I	GGNCC	1 cut(s)	70
SchI	GAGTC	1 cut(s)	125
SetI	ASST	1 cut(s)	237
SgeI	CNNG	5 cut(s)	114, 135, 155, 173, 241
SinI	GGWCC	1 cut(s)	70
Sse9I	AATT	4 cut(s)	96, 106, 178, 247
SspMI	CTAG	2 cut(s)	102, 123
TasI	AATT	4 cut(s)	96, 106, 178, 247
TfiI	GAWTC	1 cut(s)	41
TscAI	CASTG	1 cut(s)	213
TspDTI	ATGAA	2 cut(s)	51, 189
TspRI	CASTG	1 cut(s)	213
VpaK11BI	GGWCC	1 cut(s)	70
XapI	RAATTY	1 cut(s)	178
XspI	CTAG	2 cut(s)	102, 123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.