Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8397459.1

Orthogroup ID

OG0001043

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 333

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8397459.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

atggagggtcgtcaaagcaacaacatggaggaaatcaagatgatgattcaacaacttgcagaatgtatcaatcgcattgaaactaaatggcaaggaggtaagagttgccacagggagagagacgtttaccaacatgtcacttgcatcgaaacctcatgccaagacggtgagtgttccgatggggagggagacgttggcccttttcatcactgtgctccgttgtgtgagtcaaatgaaagggcagaaccg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

83

Amino Acids

9.44

Weight (kDa)

4.81

Isoelectric Point (pI)

67.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001043)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g07634
prunus_persica	Prupe.1G102800_v2.0.a1 Prupe.8G086900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0246931
rosa_laevigata	RLG00000003129 RLG00000005865 RLG00000005867 RLG00000008042 RLG00000017998 RLG00000019187 RLG00000019483 RLG00000022446 RLG00000023139 RLG00000032380 RLG00000034989 RLG00000037076
rosa_multiflora	Rmu_co8397459.1_g000001 Rmu_sc0000195.1_g000037 Rmu_sc0000516.1_g000018 Rmu_sc0001091.1_g000004 Rmu_sc0001113.1_g000012 Rmu_sc0001673.1_g000033 Rmu_sc0001694.1_g000016 Rmu_sc0001793.1_g000051 Rmu_sc0002676.1_g000007 Rmu_sc0002986.1_g000020 Rmu_sc0004253.1_g000001 Rmu_sc0004478.1_g000012 Rmu_sc0004614.1_g000007 Rmu_sc0005387.1_g000002 Rmu_sc0006592.1_g000013 Rmu_sc0006967.1_g000011 Rmu_sc0011039.1_g000002 Rmu_sc0016880.1_g000004 Rmu_ssc0000182.1_g000020
rosa_roxburghii	Rroxscaffold_1G00024880 Rroxscaffold_1G00053230 Rroxscaffold_1G00068810 Rroxscaffold_1G00068820 Rroxscaffold_2G00094300 Rroxscaffold_2G00095320 Rroxscaffold_2G00095330 Rroxscaffold_2G00108180 Rroxscaffold_2G00130520 Rroxscaffold_2G00131280 Rroxscaffold_3G00229800 Rroxscaffold_4G00279060 Rroxscaffold_4G00312500 Rroxscaffold_4G00312510 Rroxscaffold_7G00215840
rosa_samantha	Rh1BG408300 Rh3AG269100 Rh3CG198400 Rh3CG303300 Rh5AG056400 Rh5DG052900 Rh5DG388100 Rh7BG462700 Rh7CG506000
rosa_wichuraiana	Rw1G013080 Rw2G016330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflIII	ACRYGT	1 cut(s)	133
AgsI	TTSAA	2 cut(s)	50, 80
Alw21I	GWGCWC	1 cut(s)	217
Alw26I	GTCTC	2 cut(s)	114, 183
AoxI	GGCC	1 cut(s)	196
AspS9I	GGNCC	1 cut(s)	197
AsuHPI	GGTGA	1 cut(s)	179
Bbv12I	GWGCWC	1 cut(s)	217
BccI	CCATC	1 cut(s)	173
BcoDI	GTCTC	2 cut(s)	114, 183
BmgT120I	GGNCC	1 cut(s)	197
BmsI	GCATC	1 cut(s)	153
BshFI	GGCC	1 cut(s)	198
BsiHKAI	GWGCWC	1 cut(s)	217
BsmAI	GTCTC	2 cut(s)	114, 183
BsmBI	CGTCTC	2 cut(s)	114, 183
BsnI	GGCC	1 cut(s)	198
Bsp1286I	GDGCHC	1 cut(s)	217
BspANI	GGCC	1 cut(s)	198
Bst4CI	ACNGT	2 cut(s)	167, 212
BstMAI	GTCTC	2 cut(s)	114, 183
BstNSI	RCATGY	1 cut(s)	137
BsuRI	GGCC	1 cut(s)	198
BtsIMutI	CAGTG	1 cut(s)	208
Cfr13I	GGNCC	1 cut(s)	197
CviAII	CATG	3 cut(s)	25, 134, 156
CviJI	RGCY	1 cut(s)	198
CviKI_1	RGCY	1 cut(s)	198
Esp3I	CGTCTC	2 cut(s)	114, 183
FaeI	CATG	3 cut(s)	28, 137, 159
FaiI	YATR	3 cut(s)	26, 135, 157
FatI	CATG	3 cut(s)	24, 133, 155
HaeIII	GGCC	1 cut(s)	198
Hin1II	CATG	3 cut(s)	28, 137, 159
HinfI	GANTC	2 cut(s)	46, 227
HphI	GGTGA	1 cut(s)	179
Hpy166II	GTNNAC	1 cut(s)	127
Hpy188I	TCNGA	1 cut(s)	178
Hpy188III	TCNNGA	1 cut(s)	37
Hpy8I	GTNNAC	1 cut(s)	127
HpyCH4III	ACNGT	2 cut(s)	167, 212
HpyCH4IV	ACGT	2 cut(s)	123, 192
HpyCH4V	TGCA	2 cut(s)	59, 144
HpySE526I	ACGT	2 cut(s)	123, 192
Hsp92II	CATG	3 cut(s)	28, 137, 159
LmnI	GCTCC	1 cut(s)	220
LpnPI	CCDG	1 cut(s)	97
LweI	GCATC	1 cut(s)	153
MaeII	ACGT	2 cut(s)	123, 192
MaeIII	GTNAC	1 cut(s)	136
MhlI	GDGCHC	1 cut(s)	217
MlyI	GAGTC	1 cut(s)	236
MnlI	CCTC	4 cut(s)	22, 89, 163, 178
MslI	CAYNNNNRTG	1 cut(s)	210
NlaIII	CATG	3 cut(s)	28, 137, 159
NmuCI	GTSAC	1 cut(s)	136
NspI	RCATGY	1 cut(s)	137
PciI	ACATGT	1 cut(s)	133
PfeI	GAWTC	1 cut(s)	46
PleI	GAGTC	1 cut(s)	235
PpsI	GAGTC	1 cut(s)	235
PscI	ACATGT	1 cut(s)	133
PspPI	GGNCC	1 cut(s)	197
RseI	CAYNNNNRTG	1 cut(s)	210
Sau96I	GGNCC	1 cut(s)	197
SchI	GAGTC	1 cut(s)	236
SduI	GDGCHC	1 cut(s)	217
SetI	ASST	4 cut(s)	100, 126, 155, 195
SfaNI	GCATC	1 cut(s)	153
SgeI	CNNG	9 cut(s)	37, 49, 68, 104, 124, 146, 153, 168, 173
SmiMI	CAYNNNNRTG	1 cut(s)	210
TaaI	ACNGT	2 cut(s)	167, 212
TaiI	ACGT	2 cut(s)	126, 195
TaqI	TCGA	1 cut(s)	147
TfiI	GAWTC	1 cut(s)	46
TscAI	CASTG	1 cut(s)	215
TseFI	GTSAC	1 cut(s)	136
Tsp45I	GTSAC	1 cut(s)	136
TspDTI	ATGAA	2 cut(s)	194, 249
TspGWI	ACGGA	1 cut(s)	207
TspRI	CASTG	1 cut(s)	215
XceI	RCATGY	1 cut(s)	137

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.