Rmu_sc0002986.1_g000020

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002986.1
OG0001043
Physical Location & Seq
Reverse (-)
92415 .. 93366
952 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002986.1_g000020.1.cds

Sequence Viewer

Length: 687 bp
atgtctcaggtcgggcgaagaaggggaggtttccgaatggagggtcgtgacatcaacaacgacatggctgaaatcaaaaggatgcttcagcaacttgcggatgaaggtatgaacacatttaacgattttgttatatcaagttcttcttctaattcattgaacttggatatgccgccacttctagataattatgcttctgaagattgcgatgaaaattgcttggagattgaaggggttgacctgcccatgcaaaggattcatctcccagtgcaacaaaatatcattaaaaccatgccagtccatcttgtgaaaacatcatcagcaattgtaagtcatgaaattaattcatgcatgggtgatatctttgaattggatgatcatgtgcgtaattcagatccaaagcccaaactagatgtggatgtggacattgttttaggatctcaagaaatagaacatagcatgtgtgggtcaatacgtgagcatcctaatagaattgttggtgttgatcttaagaagtcatttgtctccaacaagctggcgaagagtgttgaatctaaaagcaaagatgcatccctcaaatttcatgatccattacaagaagaagcaactcatcaatttattgatttcattggggttagtattttctacttacagattccgaagatattaattgatattgcatgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

228

Amino Acids

25.63

Weight (kDa)

4.97

Isoelectric Point (pI)

54.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 249
AciI CCGC 2 cut(s) 98, 173
AclWI GGATC 3 cut(s) 389, 445, 581
AcsI RAATTY 1 cut(s) 578
AcuI CTGAAG 2 cut(s) 71, 219
AfiI CCNNNNNNNGG 2 cut(s) 40, 252
AflII CTTAAG 1 cut(s) 509
AgsI TTSAA 4 cut(s) 160, 230, 368, 551
AluBI AGCT 1 cut(s) 535
AluI AGCT 1 cut(s) 535
Alw26I GTCTC 2 cut(s) 9, 529
AlwI GGATC 3 cut(s) 389, 445, 581
ApoI RAATTY 1 cut(s) 578
ArsI GACNNNNNNTTYG 2 cut(s) 28, 60
AseI ATTAAT 2 cut(s) 342, 668
AsuHPI GGTGA 1 cut(s) 368
BccI CCATC 1 cut(s) 309
BclI TGATCA 1 cut(s) 376
BcoDI GTCTC 2 cut(s) 9, 529
BfaI CTAG 2 cut(s) 182, 410
BfrI CTTAAG 1 cut(s) 509
BfuAI ACCTGC 1 cut(s) 249
BisI GCNGC 1 cut(s) 173
BlsI GCNGC 1 cut(s) 174
BmrI ACTGGG 1 cut(s) 260
BmsI GCATC 4 cut(s) 72, 490, 556, 578
BmuI ACTGGG 1 cut(s) 260
BpuEI CTTGAG 1 cut(s) 426
BsaAI YACGTR 1 cut(s) 476
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 252
Bse1I ACTGG 2 cut(s) 266, 296
BseGI GGATG 6 cut(s) 87, 106, 379, 424, 481, 569
BseLI CCNNNNNNNGG 2 cut(s) 40, 252
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 2 cut(s) 266, 296
BslI CCNNNNNNNGG 2 cut(s) 40, 252
BsmAI GTCTC 2 cut(s) 9, 529
Bsp143I GATC 5 cut(s) 376, 394, 437, 505, 586
BspACI CCGC 2 cut(s) 98, 173
BspCNI CTCAG 1 cut(s) 19
BspHI TCATGA 2 cut(s) 334, 583
BspMI ACCTGC 1 cut(s) 249
BspPI GGATC 3 cut(s) 389, 445, 581
BspTI CTTAAG 1 cut(s) 509
BsrI ACTGG 2 cut(s) 266, 296
BssMI GATC 5 cut(s) 376, 394, 437, 505, 586
Bst6I CTCTTC 1 cut(s) 536
BstAFI CTTAAG 1 cut(s) 509
BstBAI YACGTR 1 cut(s) 476
BstC8I GCNNGC 1 cut(s) 537
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 6 cut(s) 87, 106, 379, 424, 481, 569
BstKTI GATC 5 cut(s) 379, 397, 440, 508, 589
BstMAI GTCTC 2 cut(s) 9, 529
BstMBI GATC 5 cut(s) 376, 394, 437, 505, 586
BstNSI RCATGY 2 cut(s) 463, 684
BstX2I RGATCY 2 cut(s) 394, 437
BstXI CCANNNNNNTGG 1 cut(s) 535
BstYI RGATCY 2 cut(s) 394, 437
BtgZI GCGATG 1 cut(s) 222
BtsCI GGATG 6 cut(s) 87, 106, 379, 424, 481, 569
BtsIMutI CAGTG 1 cut(s) 273
BveI ACCTGC 1 cut(s) 249
Cac8I GCNNGC 1 cut(s) 537
CciI TCATGA 2 cut(s) 334, 583
CviJI RGCY 3 cut(s) 68, 403, 535
CviKI_1 RGCY 3 cut(s) 68, 403, 535
DdeI CTNAG 1 cut(s) 6
DpnI GATC 5 cut(s) 378, 396, 439, 507, 588
DpnII GATC 5 cut(s) 376, 394, 437, 505, 586
Eam1104I CTCTTC 1 cut(s) 536
EarI CTCTTC 1 cut(s) 536
Eco32I GATATC 1 cut(s) 361
Eco57I CTGAAG 2 cut(s) 71, 219
EcoRV GATATC 1 cut(s) 361
EcoT22I ATGCAT 2 cut(s) 353, 571
FalI AAGNNNNNCTT 2 cut(s) 130, 162
FbaI TGATCA 1 cut(s) 376
Fnu4HI GCNGC 1 cut(s) 173
FokI GGATG 6 cut(s) 94, 113, 386, 431, 468, 556
Fsp4HI GCNGC 1 cut(s) 173
FspBI CTAG 2 cut(s) 182, 410
GluI GCNGC 1 cut(s) 173
HincII GTYRAC 1 cut(s) 238
HindII GTYRAC 1 cut(s) 238
HinfI GANTC 3 cut(s) 256, 551, 655
HphI GGTGA 1 cut(s) 368
Hpy166II GTNNAC 2 cut(s) 238, 424
Hpy188I TCNGA 4 cut(s) 35, 199, 394, 660
Hpy188III TCNNGA 5 cut(s) 47, 182, 335, 443, 584
Hpy8I GTNNAC 2 cut(s) 238, 424
HpyAV CCTTC 3 cut(s) 15, 98, 224
HpyCH4IV ACGT 1 cut(s) 475
HpyCH4V TGCA 5 cut(s) 250, 271, 351, 569, 680
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 1 cut(s) 475
Ksp22I TGATCA 1 cut(s) 376
Kzo9I GATC 5 cut(s) 376, 394, 437, 505, 586
LpnPI CCDG 4 cut(s) 254, 279, 309, 521
LweI GCATC 4 cut(s) 72, 490, 556, 578
MaeI CTAG 2 cut(s) 182, 410
MaeII ACGT 1 cut(s) 475
MaeIII GTNAC 1 cut(s) 47
MalI GATC 5 cut(s) 378, 396, 439, 507, 588
MboI GATC 5 cut(s) 376, 394, 437, 505, 586
MboII GAAGA 7 cut(s) 30, 135, 138, 212, 553, 611, 673
MfeI CAATTG 1 cut(s) 324
MflI RGATCY 2 cut(s) 394, 437
MmeI TCCRAC 1 cut(s) 552
MnlI CCTC 3 cut(s) 20, 34, 584
Mph1103I ATGCAT 2 cut(s) 353, 571
MseI TTAA 6 cut(s) 120, 285, 342, 510, 668, 685
MspCI CTTAAG 1 cut(s) 509
MunI CAATTG 1 cut(s) 324
NdeII GATC 5 cut(s) 376, 394, 437, 505, 586
NmuCI GTSAC 1 cut(s) 47
NsiI ATGCAT 2 cut(s) 353, 571
NspI RCATGY 2 cut(s) 463, 684
PagI TCATGA 2 cut(s) 334, 583
PfeI GAWTC 3 cut(s) 256, 551, 655
PkrI GCNGC 1 cut(s) 174
Ppu21I YACGTR 1 cut(s) 476
PshBI ATTAAT 2 cut(s) 342, 668
PsuI RGATCY 2 cut(s) 394, 437
SaqAI TTAA 6 cut(s) 120, 285, 342, 510, 668, 685
SatI GCNGC 1 cut(s) 173
Sau3AI GATC 5 cut(s) 376, 394, 437, 505, 586
SetI ASST 6 cut(s) 12, 31, 109, 243, 478, 537
SfaNI GCATC 4 cut(s) 72, 490, 556, 578
SmlI CTYRAG 2 cut(s) 441, 509
SmoI CTYRAG 2 cut(s) 441, 509
SsiI CCGC 2 cut(s) 98, 173
SspMI CTAG 2 cut(s) 182, 410
TaiI ACGT 1 cut(s) 478
TauI GCSGC 1 cut(s) 175
TfiI GAWTC 3 cut(s) 256, 551, 655
Tru1I TTAA 6 cut(s) 120, 285, 342, 510, 668, 685
Tru9I TTAA 6 cut(s) 120, 285, 342, 510, 668, 685
TscAI CASTG 1 cut(s) 273
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 9 cut(s) 117, 125, 144, 225, 248, 336, 351, 572, 616
TspRI CASTG 1 cut(s) 273
Vha464I CTTAAG 1 cut(s) 509
VspI ATTAAT 2 cut(s) 342, 668
XapI RAATTY 1 cut(s) 578
XbaI TCTAGA 1 cut(s) 181
XceI RCATGY 2 cut(s) 463, 684
XcmI CCANNNNNNNNNTGG 1 cut(s) 412
XspI CTAG 2 cut(s) 182, 410
Zsp2I ATGCAT 2 cut(s) 353, 571
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.