Rroxscaffold_1G00068810

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001043
Physical Location & Seq
Forward (+)
89894475 .. 89895074
600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00068810.1

Sequence Viewer

Length: 441 bp
ATGGTGGATTCCATGGCTCAAAGCAGGCTTGATCGGGAAGGTTCTCTAATGGAGGGTTATAGCAACGACATGGAGGAAATTAAGATGATGATTCAACAACTTGCAGAAATCACATCGAAACTTGATGCCAAGGAGGTAAGAGATGCAACGGGGAAAGAGACGTTTATCAACGTGTCACTTACATTGAAACCTCATGCCAAGATGATGTGGGTTATGACGAGGAGGGAGATATTGGTCTTTTTCATCACTGTGCTCCATTTCGCTTGTTGTGGCAATTATAATGATCAGATTTGTGATGGGAATTGTTTGGAGGTTGAAAGTAATATTGATGAACATGGTAGCAATATTATTGATAAAGGGTTTAAGCTAGCAGTACGAAATATTACTATGCACATGCAAGAAATTGATCTAATTATCCAGTCGTTGAAGCTACCGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

16.74

Weight (kDa)

5.04

Isoelectric Point (pI)

47.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 279
AfaI GTAC 2 cut(s) 375, 437
AflIII ACRYGT 1 cut(s) 171
AgsI TTSAA 4 cut(s) 95, 187, 317, 427
AluBI AGCT 2 cut(s) 367, 430
AluI AGCT 2 cut(s) 367, 430
Alw21I GWGCWC 1 cut(s) 255
Alw26I GTCTC 1 cut(s) 152
AsuNHI GCTAGC 1 cut(s) 367
BarI GAAGNNNNNNTAC 1 cut(s) 419
Bbv12I GWGCWC 1 cut(s) 255
BccI CCATC 1 cut(s) 290
BclI TGATCA 1 cut(s) 283
BcoDI GTCTC 1 cut(s) 152
BfaI CTAG 2 cut(s) 368, 439
BmsI GCATC 2 cut(s) 115, 133
BmtI GCTAGC 1 cut(s) 371
BsaJI CCNNGG 2 cut(s) 12, 129
Bse1I ACTGG 1 cut(s) 418
BseDI CCNNGG 2 cut(s) 12, 129
BseNI ACTGG 1 cut(s) 418
BseRI GAGGAG 1 cut(s) 235
BsiHKAI GWGCWC 1 cut(s) 255
BsmAI GTCTC 1 cut(s) 152
BsmBI CGTCTC 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 255
Bsp143I GATC 3 cut(s) 31, 283, 406
Bsp19I CCATGG 1 cut(s) 12
BspOI GCTAGC 1 cut(s) 371
BsrI ACTGG 1 cut(s) 418
BssECI CCNNGG 2 cut(s) 12, 129
BssMI GATC 3 cut(s) 31, 283, 406
BssT1I CCWWGG 2 cut(s) 12, 129
Bst4CI ACNGT 2 cut(s) 250, 435
BstC8I GCNNGC 2 cut(s) 26, 369
BstDSI CCRYGG 1 cut(s) 12
BstKTI GATC 3 cut(s) 34, 286, 409
BstMAI GTCTC 1 cut(s) 152
BstMBI GATC 3 cut(s) 31, 283, 406
BstNSI RCATGY 1 cut(s) 397
BtgI CCRYGG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 246
Cac8I GCNNGC 2 cut(s) 26, 369
Csp6I GTAC 2 cut(s) 374, 436
CviAII CATG 5 cut(s) 13, 70, 194, 335, 394
CviJI RGCY 4 cut(s) 17, 28, 367, 430
CviKI_1 RGCY 4 cut(s) 17, 28, 367, 430
CviQI GTAC 2 cut(s) 374, 436
DpnI GATC 3 cut(s) 33, 285, 408
DpnII GATC 3 cut(s) 31, 283, 406
Eco130I CCWWGG 2 cut(s) 12, 129
EcoT14I CCWWGG 2 cut(s) 12, 129
ErhI CCWWGG 2 cut(s) 12, 129
Esp3I CGTCTC 1 cut(s) 152
FaeI CATG 5 cut(s) 16, 73, 197, 338, 397
FaiI YATR 9 cut(s) 14, 60, 71, 195, 215, 279, 336, 389, 395
FatI CATG 5 cut(s) 12, 69, 193, 334, 393
FbaI TGATCA 1 cut(s) 283
FspBI CTAG 2 cut(s) 368, 439
Hin1II CATG 5 cut(s) 16, 73, 197, 338, 397
HinfI GANTC 2 cut(s) 8, 91
Hpy188I TCNGA 1 cut(s) 288
Hpy188III TCNNGA 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 2 cut(s) 250, 435
HpyCH4IV ACGT 2 cut(s) 161, 171
HpyCH4V TGCA 4 cut(s) 104, 146, 391, 397
HpySE526I ACGT 2 cut(s) 161, 171
Hsp92II CATG 5 cut(s) 16, 73, 197, 338, 397
Ksp22I TGATCA 1 cut(s) 283
Kzo9I GATC 3 cut(s) 31, 283, 406
LmnI GCTCC 1 cut(s) 258
LpnPI CCDG 2 cut(s) 10, 431
LweI GCATC 2 cut(s) 115, 133
MaeI CTAG 2 cut(s) 368, 439
MaeII ACGT 2 cut(s) 161, 171
MaeIII GTNAC 1 cut(s) 174
MalI GATC 3 cut(s) 33, 285, 408
MboI GATC 3 cut(s) 31, 283, 406
MhlI GDGCHC 1 cut(s) 255
MluCI AATT 5 cut(s) 78, 274, 301, 402, 411
MnlI CCTC 7 cut(s) 46, 67, 127, 201, 213, 216, 304
MseI TTAA 2 cut(s) 81, 363
MslI CAYNNNNRTG 1 cut(s) 248
NcoI CCATGG 1 cut(s) 12
NdeII GATC 3 cut(s) 31, 283, 406
NheI GCTAGC 1 cut(s) 367
NlaIII CATG 5 cut(s) 16, 73, 197, 338, 397
NmuCI GTSAC 1 cut(s) 174
NspI RCATGY 1 cut(s) 397
PfeI GAWTC 2 cut(s) 8, 91
PsiI TTATAA 1 cut(s) 279
RsaI GTAC 2 cut(s) 375, 437
RsaNI GTAC 2 cut(s) 374, 436
RseI CAYNNNNRTG 1 cut(s) 248
SaqAI TTAA 2 cut(s) 81, 363
Sau3AI GATC 3 cut(s) 31, 283, 406
SduI GDGCHC 1 cut(s) 255
SetI ASST 8 cut(s) 43, 138, 164, 174, 193, 315, 369, 432
SfaNI GCATC 2 cut(s) 115, 133
SmiMI CAYNNNNRTG 1 cut(s) 248
Sse9I AATT 5 cut(s) 78, 274, 301, 402, 411
SspI AATATT 3 cut(s) 325, 346, 382
SspMI CTAG 2 cut(s) 368, 439
StyI CCWWGG 2 cut(s) 12, 129
TaaI ACNGT 2 cut(s) 250, 435
TaiI ACGT 2 cut(s) 164, 174
TaqI TCGA 1 cut(s) 116
TasI AATT 5 cut(s) 78, 274, 301, 402, 411
TfiI GAWTC 2 cut(s) 8, 91
Tru1I TTAA 2 cut(s) 81, 363
Tru9I TTAA 2 cut(s) 81, 363
TscAI CASTG 1 cut(s) 253
TseFI GTSAC 1 cut(s) 174
Tsp45I GTSAC 1 cut(s) 174
TspDTI ATGAA 2 cut(s) 232, 345
TspRI CASTG 1 cut(s) 253
XceI RCATGY 1 cut(s) 397
XspI CTAG 2 cut(s) 368, 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.