Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5D

Orthogroup ID

OG0001043

Physical Location & Seq

Genomic Coordinates Forward (+)

4510301 .. 4510645

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5DG052900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

ATGAGTTTTGATAAACCACCGAAGTATGATTGTTATGAAGATTCTGAAGTTTGTGATGGTGATGTGGAGGACCAAAAGAGAAATGATTGTGTTCTATTTGCTAGAAATTGTGATAAGTCCTCTAGTAAAAATAGCAAAGAACTTGACATTGAAAAACAACTTGAAGGAGAAGATGAAAACTTGTTTGTATTAGATAGAATGTTTACCACTGCCTCTGTTAGTTCTCTTCCTGAAGTTATTGATCCAAAATTGAATGCTGATTTGGTGCCTTCATGCTCACGGAAAGATAATGTTTCGTACATTTTAAAAGAGAACTCAAATATGGAATGGAAGTATCTTGGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

114

Amino Acids

13.06

Weight (kDa)

4.42

Isoelectric Point (pI)

50.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001043)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g07634
prunus_persica	Prupe.1G102800_v2.0.a1 Prupe.8G086900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0246931
rosa_laevigata	RLG00000003129 RLG00000005865 RLG00000005867 RLG00000008042 RLG00000017998 RLG00000019187 RLG00000019483 RLG00000022446 RLG00000023139 RLG00000032380 RLG00000034989 RLG00000037076
rosa_multiflora	Rmu_co8397459.1_g000001 Rmu_sc0000195.1_g000037 Rmu_sc0000516.1_g000018 Rmu_sc0001091.1_g000004 Rmu_sc0001113.1_g000012 Rmu_sc0001673.1_g000033 Rmu_sc0001694.1_g000016 Rmu_sc0001793.1_g000051 Rmu_sc0002676.1_g000007 Rmu_sc0002986.1_g000020 Rmu_sc0004253.1_g000001 Rmu_sc0004478.1_g000012 Rmu_sc0004614.1_g000007 Rmu_sc0005387.1_g000002 Rmu_sc0006592.1_g000013 Rmu_sc0006967.1_g000011 Rmu_sc0011039.1_g000002 Rmu_sc0016880.1_g000004 Rmu_ssc0000182.1_g000020
rosa_roxburghii	Rroxscaffold_1G00024880 Rroxscaffold_1G00053230 Rroxscaffold_1G00068810 Rroxscaffold_1G00068820 Rroxscaffold_2G00094300 Rroxscaffold_2G00095320 Rroxscaffold_2G00095330 Rroxscaffold_2G00108180 Rroxscaffold_2G00130520 Rroxscaffold_2G00131280 Rroxscaffold_3G00229800 Rroxscaffold_4G00279060 Rroxscaffold_4G00312500 Rroxscaffold_4G00312510 Rroxscaffold_7G00215840
rosa_samantha	Rh1BG408300 Rh3AG269100 Rh3CG198400 Rh3CG303300 Rh5AG056400 Rh5DG052900 Rh5DG388100 Rh7BG462700 Rh7CG506000
rosa_wichuraiana	Rw1G013080 Rw2G016330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	265
AclWI	GGATC	1 cut(s)	236
AcuI	CTGAAG	2 cut(s)	66, 252
AfaI	GTAC	1 cut(s)	299
AgsI	TTSAA	3 cut(s)	152, 164, 253
AjuI	GAANNNNNNNTTGG	2 cut(s)	245, 277
AlwI	GGATC	1 cut(s)	236
AspS9I	GGNCC	1 cut(s)	70
AsuHPI	GGTGA	1 cut(s)	71
AvaII	GGWCC	1 cut(s)	70
BanI	GGYRCC	1 cut(s)	265
BccI	CCATC	1 cut(s)	50
BfaI	CTAG	2 cut(s)	102, 123
Bme18I	GGWCC	1 cut(s)	70
BmgT120I	GGNCC	1 cut(s)	70
BmiI	GGNNCC	1 cut(s)	267
BshNI	GGYRCC	1 cut(s)	265
BsmI	GAATGC	1 cut(s)	259
Bsp143I	GATC	1 cut(s)	241
BspLI	GGNNCC	1 cut(s)	267
BspPI	GGATC	1 cut(s)	236
BspT107I	GGYRCC	1 cut(s)	265
BssMI	GATC	1 cut(s)	241
Bst6I	CTCTTC	1 cut(s)	231
BstKTI	GATC	1 cut(s)	244
BstMBI	GATC	1 cut(s)	241
BtsI	GCAGTG	1 cut(s)	207
BtsIMutI	CAGTG	1 cut(s)	207
Cfr13I	GGNCC	1 cut(s)	70
Csp6I	GTAC	1 cut(s)	298
CviAII	CATG	1 cut(s)	273
CviQI	GTAC	1 cut(s)	298
DpnI	GATC	1 cut(s)	243
DpnII	GATC	1 cut(s)	241
DraI	TTTAAA	1 cut(s)	306
Eam1104I	CTCTTC	1 cut(s)	231
EarI	CTCTTC	1 cut(s)	231
Eco47I	GGWCC	1 cut(s)	70
Eco57I	CTGAAG	2 cut(s)	66, 252
FaeI	CATG	1 cut(s)	276
FaiI	YATR	4 cut(s)	27, 36, 274, 323
FatI	CATG	1 cut(s)	272
FspBI	CTAG	2 cut(s)	102, 123
Hin1II	CATG	1 cut(s)	276
HinfI	GANTC	1 cut(s)	41
HphI	GGTGA	1 cut(s)	71
Hpy166II	GTNNAC	1 cut(s)	204
Hpy188I	TCNGA	1 cut(s)	46
Hpy188III	TCNNGA	1 cut(s)	230
Hpy8I	GTNNAC	1 cut(s)	204
HpyAV	CCTTC	2 cut(s)	158, 279
Hsp92II	CATG	1 cut(s)	276
Kzo9I	GATC	1 cut(s)	241
LpnPI	CCDG	1 cut(s)	243
MaeI	CTAG	2 cut(s)	102, 123
MalI	GATC	1 cut(s)	243
MboI	GATC	1 cut(s)	241
MboII	GAAGA	3 cut(s)	50, 182, 218
MluCI	AATT	2 cut(s)	106, 248
MnlI	CCTC	3 cut(s)	61, 130, 223
MseI	TTAA	1 cut(s)	305
Mva1269I	GAATGC	1 cut(s)	259
NdeII	GATC	1 cut(s)	241
NlaIII	CATG	1 cut(s)	276
NlaIV	GGNNCC	1 cut(s)	267
PctI	GAATGC	1 cut(s)	259
PfeI	GAWTC	1 cut(s)	41
PspN4I	GGNNCC	1 cut(s)	267
PspPI	GGNCC	1 cut(s)	70
RsaI	GTAC	1 cut(s)	299
RsaNI	GTAC	1 cut(s)	298
SaqAI	TTAA	1 cut(s)	305
Sau3AI	GATC	1 cut(s)	241
Sau96I	GGNCC	1 cut(s)	70
SgeI	CNNG	8 cut(s)	114, 135, 155, 173, 193, 242, 285, 291
SinI	GGWCC	1 cut(s)	70
Sse9I	AATT	2 cut(s)	106, 248
SspMI	CTAG	2 cut(s)	102, 123
TasI	AATT	2 cut(s)	106, 248
TfiI	GAWTC	1 cut(s)	41
Tru1I	TTAA	1 cut(s)	305
Tru9I	TTAA	1 cut(s)	305
TscAI	CASTG	1 cut(s)	214
TspDTI	ATGAA	3 cut(s)	51, 189, 261
TspGWI	ACGGA	1 cut(s)	295
TspRI	CASTG	1 cut(s)	214
VpaK11BI	GGWCC	1 cut(s)	70
XspI	CTAG	2 cut(s)	102, 123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.