Rmu_sc0001694.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001694.1
OG0001043
Physical Location & Seq
Reverse (-)
104954 .. 107161
2208 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001694.1_g000016.1.cds

Sequence Viewer

Length: 1545 bp
atggagggtcgttatagcaacgacatggaggaaatcaagatgatgattcaacaacttgcaaaacatatcaatcgcatcgaaactcgacgcctaggaggtaagagttacgacggggagagagacgtttatcagcgtgtcacttgcatcgaaacctcttgccaagacggtgtgggttttgacggggaggaagacgttggccattttcatcactgtgctttgttgtgtgagtcggacgaaaaggtggaaccggttagtttcgactatgaaggttcaaatactatttttaatttttcagttgataaaagtttggaaaaagaaaataaagttggagttgtggattttagtttgccaccaatttataattgtttttgtgaggcgtgcagtggcaattgtgatgatcagatttgtgatggaaattgtttggaggttgaaggtaatattgatcttgatcggggaggttctcgaatggagggtcgttatagcaacgacatggaggaaatcaagatgatgattcaacaacttgcaaaacatatcaatcgcatcgaaactcgacgcctaggaggtaagagttacgacggggagagagacgtttatcagcgtgtcacttgcatcgaaacctcttgccaagacggtgtgggttttgacggggagggagacgttggccattttcatcactgtgctttgttgtgtgagtcggacgaaaaggtggaaccggttagtttcgactatgaaggttcaaatactatttttaatttttcagttgataaaagtttggaaaaagaaaataaagttggagttgtggattttagtttgccaccaatttataattgtttttgtgaggcgtgcagtggcaattgtgatgatcagatttgtgatggaaattgtttggaggttgaaggtaatattgatgaacatggtagctatactattgataaagggtcggagctagcagtagaaaatattactatgcacatgcaaggaattgatccaattatacaagtcgatgaagctaatgtaccatcaattgaagtggaagacctatacccatatataggtattgagaaaattgatgtgggtgagaggattgatgatatgaactcaaaccatggtaatattgatgaacatggtagctatactattgataaagggtcggagctagcagtagaaaatattactacgcacatgcaaggaattgatccaattatacaagtcgatgaagctaatgtaccatcaattgaagtggaagacctatacccatatataggcattgagaaaattgatgtgggtgagaggattgatgatatgaactcaaaccatggtcatattggtgatgccaacgtgagtttcagtcttggacttccaagaactaggcatgagccggattcaatcttggatgagagtactacaagtgctaaacgattgaccatgatggatttggatgcaatggatgattttgctaggattctctctaatttgtggcttgaattcaaggacaaattctttccaaccaggagtctgatgcaggagcatatagggatcaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

514

Amino Acids

57.72

Weight (kDa)

4.36

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 360, 825
AclWI GGATC 3 cut(s) 980, 1190, 1544
AcoI YGGCCR 2 cut(s) 196, 661
AcsI RAATTY 2 cut(s) 1484, 1496
AcyI GRCGYC 2 cut(s) 88, 553
AfaI GTAC 3 cut(s) 1017, 1227, 1402
AfiI CCNNNNNNNGG 2 cut(s) 1052, 1262
AgeI ACCGGT 2 cut(s) 247, 712
AjnI CCWGG 1 cut(s) 1508
AjuI GAANNNNNNNTTGG 6 cut(s) 309, 341, 774, 806, 1328, 1360
AluBI AGCT 6 cut(s) 921, 946, 1010, 1131, 1156, 1220
AluI AGCT 6 cut(s) 921, 946, 1010, 1131, 1156, 1220
Alw26I GTCTC 3 cut(s) 114, 579, 648
AlwI GGATC 3 cut(s) 980, 1190, 1544
AoxI GGCC 2 cut(s) 196, 661
ApoI RAATTY 2 cut(s) 1484, 1496
ArsI GACNNNNNNTTYG 2 cut(s) 457, 489
AsiGI ACCGGT 2 cut(s) 247, 712
AspA2I CCTAGG 2 cut(s) 91, 556
AsuHPI GGTGA 3 cut(s) 1088, 1298, 1340
AsuNHI GCTAGC 2 cut(s) 946, 1156
AvrII CCTAGG 2 cut(s) 91, 556
BalI TGGCCA 2 cut(s) 198, 663
BarI GAAGNNNNNNTAC 4 cut(s) 999, 1031, 1209, 1241
BbsI GAAGAC 3 cut(s) 195, 1041, 1251
BccI CCATC 5 cut(s) 404, 869, 1027, 1237, 1423
BciT130I CCWGG 1 cut(s) 1510
BclI TGATCA 2 cut(s) 397, 862
BcoDI GTCTC 3 cut(s) 114, 579, 648
BfaI CTAG 6 cut(s) 92, 557, 947, 1157, 1368, 1458
BlnI CCTAGG 2 cut(s) 91, 556
BmcAI AGTACT 1 cut(s) 1402
Bme1390I CCNGG 1 cut(s) 1510
BmiI GGNNCC 2 cut(s) 246, 711
BmrFI CCNGG 1 cut(s) 1510
BmsI GCATC 7 cut(s) 84, 153, 549, 618, 1321, 1429, 1509
BmtI GCTAGC 2 cut(s) 950, 1160
BpiI GAAGAC 3 cut(s) 195, 1041, 1251
BsaBI GATNNNNATC 1 cut(s) 447
BsaHI GRCGYC 2 cut(s) 88, 553
BsaJI CCNNGG 4 cut(s) 91, 556, 1105, 1315
BsaWI WCCGGW 2 cut(s) 247, 712
Bsc4I CCNNNNNNNGG 2 cut(s) 1052, 1262
Bse118I RCCGGY 2 cut(s) 247, 712
Bse3DI GCAATG 1 cut(s) 1449
Bse8I GATNNNNATC 1 cut(s) 447
BseBI CCWGG 1 cut(s) 1510
BseDI CCNNGG 4 cut(s) 91, 556, 1105, 1315
BseGI GGATG 3 cut(s) 1399, 1444, 1453
BseJI GATNNNNATC 1 cut(s) 447
BseLI CCNNNNNNNGG 2 cut(s) 1052, 1262
BseMI GCAATG 1 cut(s) 1449
BsgI GTGCAG 2 cut(s) 400, 865
BshFI GGCC 2 cut(s) 198, 663
BshTI ACCGGT 2 cut(s) 247, 712
BsiSI CCGG 3 cut(s) 248, 713, 1379
BslI CCNNNNNNNGG 2 cut(s) 1052, 1262
BsmAI GTCTC 3 cut(s) 114, 579, 648
BsmBI CGTCTC 3 cut(s) 114, 579, 648
BsnI GGCC 2 cut(s) 198, 663
Bsp143I GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
Bsp19I CCATGG 2 cut(s) 1105, 1315
BspANI GGCC 2 cut(s) 198, 663
BspLI GGNNCC 2 cut(s) 246, 711
BspOI GCTAGC 2 cut(s) 950, 1160
BspPI GGATC 3 cut(s) 980, 1190, 1544
BsrDI GCAATG 1 cut(s) 1449
BsrFI RCCGGY 2 cut(s) 247, 712
BssAI RCCGGY 2 cut(s) 247, 712
BssECI CCNNGG 4 cut(s) 91, 556, 1105, 1315
BssMI GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
BssNI GRCGYC 2 cut(s) 88, 553
BssT1I CCWWGG 4 cut(s) 91, 556, 1105, 1315
Bst2UI CCWGG 1 cut(s) 1510
Bst4CI ACNGT 4 cut(s) 167, 212, 632, 677
BstACI GRCGYC 2 cut(s) 88, 553
BstC8I GCNNGC 4 cut(s) 379, 844, 948, 1158
BstDSI CCRYGG 2 cut(s) 1105, 1315
BstF5I GGATG 3 cut(s) 1399, 1444, 1453
BstKTI GATC 7 cut(s) 400, 445, 451, 865, 988, 1198, 1539
BstMAI GTCTC 3 cut(s) 114, 579, 648
BstMBI GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
BstNI CCWGG 1 cut(s) 1510
BstNSI RCATGY 2 cut(s) 976, 1186
BstSCI CCNGG 1 cut(s) 1508
BstV2I GAAGAC 3 cut(s) 195, 1041, 1251
BsuRI GGCC 2 cut(s) 198, 663
BtgI CCRYGG 2 cut(s) 1105, 1315
BtsCI GGATG 3 cut(s) 1399, 1444, 1453
BtsI GCAGTG 2 cut(s) 388, 853
BtsIMutI CAGTG 4 cut(s) 208, 388, 673, 853
Cac8I GCNNGC 4 cut(s) 379, 844, 948, 1158
Cfr10I RCCGGY 2 cut(s) 247, 712
CseI GACGC 2 cut(s) 96, 561
Csp6I GTAC 3 cut(s) 1016, 1226, 1401
CspAI ACCGGT 2 cut(s) 247, 712
CspCI CAANNNNNGTGG 4 cut(s) 1011, 1046, 1221, 1256
CviQI GTAC 3 cut(s) 1016, 1226, 1401
DpnI GATC 7 cut(s) 399, 444, 450, 864, 987, 1197, 1538
DpnII GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
EaeI YGGCCR 2 cut(s) 196, 661
Eco130I CCWWGG 4 cut(s) 91, 556, 1105, 1315
EcoRI GAATTC 1 cut(s) 1484
EcoRII CCWGG 1 cut(s) 1508
EcoT14I CCWWGG 4 cut(s) 91, 556, 1105, 1315
ErhI CCWWGG 4 cut(s) 91, 556, 1105, 1315
Esp3I CGTCTC 3 cut(s) 114, 579, 648
FbaI TGATCA 2 cut(s) 397, 862
FokI GGATG 3 cut(s) 1406, 1451, 1460
FspBI CTAG 6 cut(s) 92, 557, 947, 1157, 1368, 1458
HaeIII GGCC 2 cut(s) 198, 663
HapII CCGG 3 cut(s) 248, 713, 1379
HgaI GACGC 2 cut(s) 96, 561
Hin1I GRCGYC 2 cut(s) 88, 553
HinfI GANTC 7 cut(s) 46, 227, 511, 692, 1382, 1462, 1513
HpaII CCGG 3 cut(s) 248, 713, 1379
HphI GGTGA 3 cut(s) 1088, 1298, 1340
Hpy188I TCNGA 7 cut(s) 232, 402, 697, 867, 943, 1153, 1518
Hpy188III TCNNGA 4 cut(s) 37, 446, 462, 502
Hpy99I CGWCG 4 cut(s) 90, 113, 555, 578
HpyAV CCTTC 4 cut(s) 260, 425, 725, 890
HpyCH4III ACNGT 4 cut(s) 167, 212, 632, 677
HpyCH4IV ACGT 5 cut(s) 123, 192, 588, 657, 1338
HpySE526I ACGT 5 cut(s) 123, 192, 588, 657, 1338
Hsp92I GRCGYC 2 cut(s) 88, 553
Ksp22I TGATCA 2 cut(s) 397, 862
Kzo9I GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
LmnI GCTCC 3 cut(s) 943, 1153, 1525
LpnPI CCDG 6 cut(s) 261, 726, 1392, 1495, 1508, 1522
LweI GCATC 7 cut(s) 84, 153, 549, 618, 1321, 1429, 1509
MaeI CTAG 6 cut(s) 92, 557, 947, 1157, 1368, 1458
MaeII ACGT 5 cut(s) 123, 192, 588, 657, 1338
MaeIII GTNAC 4 cut(s) 104, 136, 569, 601
MalI GATC 7 cut(s) 399, 444, 450, 864, 987, 1197, 1538
MboI GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
MboII GAAGA 3 cut(s) 200, 1046, 1256
MfeI CAATTG 4 cut(s) 388, 853, 1023, 1233
MlsI TGGCCA 2 cut(s) 198, 663
MluNI TGGCCA 2 cut(s) 198, 663
MlyI GAGTC 3 cut(s) 236, 701, 1522
MmeI TCCRAC 7 cut(s) 210, 307, 675, 772, 921, 1131, 1529
Mox20I TGGCCA 2 cut(s) 198, 663
MscI TGGCCA 2 cut(s) 198, 663
MseI TTAA 2 cut(s) 285, 750
MslI CAYNNNNRTG 3 cut(s) 210, 675, 1326
Msp20I TGGCCA 2 cut(s) 198, 663
MspI CCGG 3 cut(s) 248, 713, 1379
MspR9I CCNGG 1 cut(s) 1510
MunI CAATTG 4 cut(s) 388, 853, 1023, 1233
MvaI CCWGG 1 cut(s) 1510
NcoI CCATGG 2 cut(s) 1105, 1315
NdeII GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
NheI GCTAGC 2 cut(s) 946, 1156
NlaIV GGNNCC 2 cut(s) 246, 711
NmuCI GTSAC 2 cut(s) 136, 601
NspI RCATGY 2 cut(s) 976, 1186
PfeI GAWTC 4 cut(s) 46, 511, 1382, 1462
PinAI ACCGGT 2 cut(s) 247, 712
PleI GAGTC 3 cut(s) 235, 700, 1521
PpsI GAGTC 3 cut(s) 235, 700, 1521
PsiI TTATAA 2 cut(s) 360, 825
Psp6I CCWGG 1 cut(s) 1508
PspGI CCWGG 1 cut(s) 1508
PspN4I GGNNCC 2 cut(s) 246, 711
RsaI GTAC 3 cut(s) 1017, 1227, 1402
RsaNI GTAC 3 cut(s) 1016, 1226, 1401
RseI CAYNNNNRTG 3 cut(s) 210, 675, 1326
SaqAI TTAA 2 cut(s) 285, 750
Sau3AI GATC 7 cut(s) 397, 442, 448, 862, 985, 1195, 1536
ScaI AGTACT 1 cut(s) 1402
SchI GAGTC 3 cut(s) 236, 701, 1522
ScrFI CCNGG 1 cut(s) 1510
SfaNI GCATC 7 cut(s) 84, 153, 549, 618, 1321, 1429, 1509
SmiMI CAYNNNNRTG 3 cut(s) 210, 675, 1326
SspI AATATT 5 cut(s) 439, 904, 961, 1114, 1171
SspMI CTAG 6 cut(s) 92, 557, 947, 1157, 1368, 1458
StyD4I CCNGG 1 cut(s) 1508
StyI CCWWGG 4 cut(s) 91, 556, 1105, 1315
TaaI ACNGT 4 cut(s) 167, 212, 632, 677
TaiI ACGT 5 cut(s) 126, 195, 591, 660, 1341
TatI WGTACW 1 cut(s) 1400
TfiI GAWTC 4 cut(s) 46, 511, 1382, 1462
Tru1I TTAA 2 cut(s) 285, 750
Tru9I TTAA 2 cut(s) 285, 750
TscAI CASTG 4 cut(s) 215, 388, 680, 853
TseFI GTSAC 2 cut(s) 136, 601
Tsp45I GTSAC 2 cut(s) 136, 601
TspRI CASTG 4 cut(s) 215, 388, 680, 853
XapI RAATTY 2 cut(s) 1484, 1496
XceI RCATGY 2 cut(s) 976, 1186
XcmI CCANNNNNNNNNTGG 2 cut(s) 1322, 1432
XmaJI CCTAGG 2 cut(s) 91, 556
XspI CTAG 6 cut(s) 92, 557, 947, 1157, 1368, 1458
ZrmI AGTACT 1 cut(s) 1402
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.