Rh5AG056400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001043
Physical Location & Seq
Forward (+)
4903974 .. 4906567
2594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG056400.1

Sequence Viewer

Length: 351 bp
ATGACACAGCAACCAAATGTCAAATCAGTGAATTGCAGATATGATTCTGAAGTTTGTGATGGTGATGTAGATGACCAAAAGAGAAATGATTGTGTTCTAATTGCTCGAAATTGTGATAAGTCCTCTAGTAAAAATAGCAAAGAACTTGACGACATTGGAAAACAACTTGAAGGAGAAGATGAAAACTTGTTTGTATTAGATAGAATGTTTACCATTGCCTCTGTTAGTTCTCTTCCTGAAGCTATTGATCCAAAATTGAATGTTGATTTGGTGCCTTCAAGCTCACGGAAAAATAATGTTTCGTACATTTTAAAAGAGAACTCAAATATGGAATGGAAGAATCTTGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.04

Weight (kDa)

4.63

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 271
AclWI GGATC 1 cut(s) 242
AcuI CTGAAG 2 cut(s) 69, 258
AfaI GTAC 1 cut(s) 305
AgsI TTSAA 3 cut(s) 170, 259, 279
AjuI GAANNNNNNNTTGG 2 cut(s) 251, 283
AluBI AGCT 2 cut(s) 242, 282
AluI AGCT 2 cut(s) 242, 282
AlwI GGATC 1 cut(s) 242
AsuHPI GGTGA 1 cut(s) 74
BanI GGYRCC 1 cut(s) 271
BccI CCATC 1 cut(s) 53
BfaI CTAG 1 cut(s) 126
BmiI GGNNCC 1 cut(s) 273
Bse3DI GCAATG 1 cut(s) 213
BseMI GCAATG 1 cut(s) 213
BshNI GGYRCC 1 cut(s) 271
Bsp143I GATC 1 cut(s) 247
BspLI GGNNCC 1 cut(s) 273
BspPI GGATC 1 cut(s) 242
BspT107I GGYRCC 1 cut(s) 271
BsrDI GCAATG 1 cut(s) 213
BssMI GATC 1 cut(s) 247
Bst6I CTCTTC 1 cut(s) 237
BstKTI GATC 1 cut(s) 250
BstMBI GATC 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 33
Csp6I GTAC 1 cut(s) 304
CviJI RGCY 2 cut(s) 242, 282
CviKI_1 RGCY 2 cut(s) 242, 282
CviQI GTAC 1 cut(s) 304
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
DraI TTTAAA 1 cut(s) 312
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
Eco57I CTGAAG 2 cut(s) 69, 258
FaiI YATR 2 cut(s) 42, 329
FspBI CTAG 1 cut(s) 126
HinfI GANTC 2 cut(s) 44, 340
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 210
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 210
HpyAV CCTTC 2 cut(s) 164, 285
HpyCH4V TGCA 1 cut(s) 36
Kzo9I GATC 1 cut(s) 247
LpnPI CCDG 1 cut(s) 249
MaeI CTAG 1 cut(s) 126
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MboII GAAGA 3 cut(s) 188, 224, 349
MluCI AATT 4 cut(s) 31, 99, 109, 254
MnlI CCTC 2 cut(s) 133, 229
MseI TTAA 1 cut(s) 311
NdeII GATC 1 cut(s) 247
NlaIV GGNNCC 1 cut(s) 273
PfeI GAWTC 2 cut(s) 44, 340
PspN4I GGNNCC 1 cut(s) 273
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
SaqAI TTAA 1 cut(s) 311
Sau3AI GATC 1 cut(s) 247
SetI ASST 2 cut(s) 244, 284
SgeI CNNG 8 cut(s) 117, 138, 158, 179, 199, 248, 291, 297
Sse9I AATT 4 cut(s) 31, 99, 109, 254
SspMI CTAG 1 cut(s) 126
TaqI TCGA 1 cut(s) 106
TasI AATT 4 cut(s) 31, 99, 109, 254
TfiI GAWTC 2 cut(s) 44, 340
Tru1I TTAA 1 cut(s) 311
Tru9I TTAA 1 cut(s) 311
TscAI CASTG 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 195
TspGWI ACGGA 1 cut(s) 301
TspRI CASTG 1 cut(s) 33
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.