Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004614.1

Orthogroup ID

OG0001043

Physical Location & Seq

Genomic Coordinates Reverse (-)

23853 .. 26555

Gene Structure 2703 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004614.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1284 bp

atggatggtcatggcatcaacaacgacatggctgaaattaaaaggatgcttcaacaacttgcggtacttatcgatcacattgaagctcgacgacgaggtcgtaagagttctgacggggagagagacgttaccacttatcatcaacgtgtcgatcacatcgaaactcgacgacaagatcgtaagagttctgacggggagagaaacgttaccacctatcatcaatgtgtcaatcgctttgaagtttcacaccaaagcaattgcgatgaaaattgcttggagattgaagcgtttgacctgcccatgcaaaggaattatctcccagtgcaacaaaatatagttaaagccatgccagtccatcttgtggaaacatcatcagcaattgtaagtcatgaaattaattcatgcatgggtgatatctttgaattggatgatcactggagctttggcaagagcttggtggattccatgtctcaagtcgggcgaagaatgggagcttttcgaatggaggatagtgacattaacaacgacatggctgaaatcaaaaggatgcttcagcaacttgcggtacgtattgatagcatcgaagctcgacgacggagtcgtagttctgacggggagagagacgttaccacctatcatcaacgtgttgatcgcatcgaaactttctaccaagatggtgacggttccgacagggagatttgcgttggcccaattcataattgtgctccgctatgtgagtcaaaggaagagggacatagtactttcaactattccggttgtaagtccagtatctttaattttccatttgttgaggaagtatttttagaaaaagaaaaaaataatttcatgagttttgatataccaccgaagtatgattgttatgaagattctgaagtttgtgatggtagtgtggaggaccaaaggaaaaatgaatttgttcctagaaattgtgatgatgaagacaacaataaagccgcaatcaattcaatattgtggaaagatattgagcataaatttgttgattttgttggagttaatgcattcattatgcatattttgaaagaattagtgaatcttgtcactcagataaaagatattgagaaaaattttgggattgcgaagttaatgtcggagagaaaatttatggggtcaaggttaataatttattccaaatatctatttgtttggaaaggaaggattcaattacaagttaaaggttcaacaaaagatatgaagccatggaagactttgtcaggatttattactttaaatattacaacgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

427

Amino Acids

49.47

Weight (kDa)

5.61

Isoelectric Point (pI)

62.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001043)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g07634
prunus_persica	Prupe.1G102800_v2.0.a1 Prupe.8G086900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0246931
rosa_laevigata	RLG00000003129 RLG00000005865 RLG00000005867 RLG00000008042 RLG00000017998 RLG00000019187 RLG00000019483 RLG00000022446 RLG00000023139 RLG00000032380 RLG00000034989 RLG00000037076
rosa_multiflora	Rmu_co8397459.1_g000001 Rmu_sc0000195.1_g000037 Rmu_sc0000516.1_g000018 Rmu_sc0001091.1_g000004 Rmu_sc0001113.1_g000012 Rmu_sc0001673.1_g000033 Rmu_sc0001694.1_g000016 Rmu_sc0001793.1_g000051 Rmu_sc0002676.1_g000007 Rmu_sc0002986.1_g000020 Rmu_sc0004253.1_g000001 Rmu_sc0004478.1_g000012 Rmu_sc0004614.1_g000007 Rmu_sc0005387.1_g000002 Rmu_sc0006592.1_g000013 Rmu_sc0006967.1_g000011 Rmu_sc0011039.1_g000002 Rmu_sc0016880.1_g000004 Rmu_ssc0000182.1_g000020
rosa_roxburghii	Rroxscaffold_1G00024880 Rroxscaffold_1G00053230 Rroxscaffold_1G00068810 Rroxscaffold_1G00068820 Rroxscaffold_2G00094300 Rroxscaffold_2G00095320 Rroxscaffold_2G00095330 Rroxscaffold_2G00108180 Rroxscaffold_2G00130520 Rroxscaffold_2G00131280 Rroxscaffold_3G00229800 Rroxscaffold_4G00279060 Rroxscaffold_4G00312500 Rroxscaffold_4G00312510 Rroxscaffold_7G00215840
rosa_samantha	Rh1BG408300 Rh3AG269100 Rh3CG198400 Rh3CG303300 Rh5AG056400 Rh5DG052900 Rh5DG388100 Rh7BG462700 Rh7CG506000
rosa_wichuraiana	Rw1G013080 Rw2G016330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	96, 597
Acc36I	ACCTGC	1 cut(s)	303
AccB7I	CCANNNNNTGG	1 cut(s)	361
AciI	CCGC	4 cut(s)	62, 563, 728, 975
AclI	AACGTT	1 cut(s)	204
AcsI	RAATTY	4 cut(s)	932, 1013, 1105, 1139
AcuI	CTGAAG	2 cut(s)	536, 912
AfaI	GTAC	3 cut(s)	66, 567, 760
AfiI	CCNNNNNNNGG	2 cut(s)	306, 361
AflIII	ACRYGT	2 cut(s)	145, 643
AloI	GAACNNNNNNTCC	2 cut(s)	589, 621
AluBI	AGCT	5 cut(s)	86, 441, 453, 494, 587
AluI	AGCT	5 cut(s)	86, 441, 453, 494, 587
Alw21I	GWGCWC	1 cut(s)	727
Alw26I	GTCTC	3 cut(s)	117, 474, 615
AoxI	GGCC	1 cut(s)	706
ApoI	RAATTY	4 cut(s)	932, 1013, 1105, 1139
ArsI	GACNNNNNNTTYG	2 cut(s)	1112, 1144
AseI	ATTAAT	1 cut(s)	396
Asp700I	GAANNNNTTC	1 cut(s)	936
AspS9I	GGNCC	2 cut(s)	707, 916
AsuHPI	GGTGA	2 cut(s)	422, 689
AsuII	TTCGAA	1 cut(s)	499
AvaII	GGWCC	1 cut(s)	916
BbsI	GAAGAC	2 cut(s)	966, 1250
Bbv12I	GWGCWC	1 cut(s)	727
BccI	CCATC	3 cut(s)	363, 668, 896
BclI	TGATCA	1 cut(s)	430
BcoDI	GTCTC	3 cut(s)	117, 474, 615
BfaI	CTAG	1 cut(s)	942
BfuAI	ACCTGC	1 cut(s)	303
BisI	GCNGC	1 cut(s)	975
BlsI	GCNGC	1 cut(s)	976
BmcAI	AGTACT	1 cut(s)	760
Bme18I	GGWCC	1 cut(s)	916
BmgT120I	GGNCC	2 cut(s)	707, 916
BmiI	GGNNCC	1 cut(s)	685
BmrI	ACTGGG	1 cut(s)	314
BmsI	GCATC	5 cut(s)	24, 36, 537, 588, 663
BmuI	ACTGGG	1 cut(s)	314
BpiI	GAAGAC	2 cut(s)	966, 1250
BpmI	CTGGAG	1 cut(s)	457
Bpu14I	TTCGAA	1 cut(s)	499
BpuEI	CTTGAG	1 cut(s)	456
Bsa29I	ATCGAT	1 cut(s)	72
BsaAI	YACGTR	1 cut(s)	569
BsaJI	CCNNGG	1 cut(s)	1238
BsaWI	WCCGGW	1 cut(s)	773
BsaXI	ACNNNNNCTCC	2 cut(s)	589, 619
Bsc4I	CCNNNNNNNGG	2 cut(s)	306, 361
Bse1I	ACTGG	4 cut(s)	320, 350, 440, 786
BseCI	ATCGAT	1 cut(s)	72
BseDI	CCNNGG	1 cut(s)	1238
BseGI	GGATG	4 cut(s)	10, 51, 433, 552
BseLI	CCNNNNNNNGG	2 cut(s)	306, 361
BseMII	CTCAG	1 cut(s)	1097
BseNI	ACTGG	4 cut(s)	320, 350, 440, 786
BshFI	GGCC	1 cut(s)	708
BshVI	ATCGAT	1 cut(s)	72
BsiHKAI	GWGCWC	1 cut(s)	727
BsiSI	CCGG	1 cut(s)	774
BslFI	GGGAC	1 cut(s)	765
BslI	CCNNNNNNNGG	2 cut(s)	306, 361
BsmAI	GTCTC	3 cut(s)	117, 474, 615
BsmBI	CGTCTC	2 cut(s)	117, 615
BsmFI	GGGAC	1 cut(s)	765
BsmI	GAATGC	1 cut(s)	1040
BsnI	GGCC	1 cut(s)	708
Bsp119I	TTCGAA	1 cut(s)	499
Bsp1286I	GDGCHC	1 cut(s)	727
Bsp143I	GATC	5 cut(s)	73, 151, 175, 430, 649
Bsp19I	CCATGG	1 cut(s)	1238
BspACI	CCGC	4 cut(s)	62, 563, 728, 975
BspANI	GGCC	1 cut(s)	708
BspCNI	CTCAG	1 cut(s)	1096
BspDI	ATCGAT	1 cut(s)	72
BspHI	TCATGA	2 cut(s)	388, 846
BspLI	GGNNCC	1 cut(s)	685
BspMI	ACCTGC	1 cut(s)	303
BspT104I	TTCGAA	1 cut(s)	499
BsrI	ACTGG	4 cut(s)	320, 350, 440, 786
BssECI	CCNNGG	1 cut(s)	1238
BssMI	GATC	5 cut(s)	73, 151, 175, 430, 649
BssT1I	CCWWGG	1 cut(s)	1238
Bst4CI	ACNGT	1 cut(s)	683
Bst6I	CTCTTC	1 cut(s)	741
BstBAI	YACGTR	1 cut(s)	569
BstBI	TTCGAA	1 cut(s)	499
BstDEI	CTNAG	1 cut(s)	1083
BstDSI	CCRYGG	1 cut(s)	1238
BstF5I	GGATG	4 cut(s)	10, 51, 433, 552
BstKTI	GATC	5 cut(s)	76, 154, 178, 433, 652
BstMAI	GTCTC	3 cut(s)	117, 474, 615
BstMBI	GATC	5 cut(s)	73, 151, 175, 430, 649
BstSNI	TACGTA	1 cut(s)	569
BstV2I	GAAGAC	2 cut(s)	966, 1250
Bsu15I	ATCGAT	1 cut(s)	72
BsuRI	GGCC	1 cut(s)	708
BsuTUI	ATCGAT	1 cut(s)	72
BtgI	CCRYGG	1 cut(s)	1238
BtgZI	GCGATG	1 cut(s)	276
BtsCI	GGATG	4 cut(s)	10, 51, 433, 552
BtsIMutI	CAGTG	2 cut(s)	327, 433
BveI	ACCTGC	1 cut(s)	303
CciI	TCATGA	2 cut(s)	388, 846
Cfr13I	GGNCC	2 cut(s)	707, 916
ClaI	ATCGAT	1 cut(s)	72
Csp6I	GTAC	3 cut(s)	65, 566, 759
CviQI	GTAC	3 cut(s)	65, 566, 759
DdeI	CTNAG	1 cut(s)	1083
DpnI	GATC	5 cut(s)	75, 153, 177, 432, 651
DpnII	GATC	5 cut(s)	73, 151, 175, 430, 649
DraI	TTTAAA	1 cut(s)	1269
DrdI	GACNNNNNNGTC	2 cut(s)	96, 597
DseDI	GACNNNNNNGTC	2 cut(s)	96, 597
Eam1104I	CTCTTC	1 cut(s)	741
EarI	CTCTTC	1 cut(s)	741
Eco105I	TACGTA	1 cut(s)	569
Eco130I	CCWWGG	1 cut(s)	1238
Eco32I	GATATC	1 cut(s)	415
Eco47I	GGWCC	1 cut(s)	916
Eco57I	CTGAAG	2 cut(s)	536, 912
EcoRV	GATATC	1 cut(s)	415
EcoT14I	CCWWGG	1 cut(s)	1238
EcoT22I	ATGCAT	3 cut(s)	407, 1042, 1053
ErhI	CCWWGG	1 cut(s)	1238
Esp3I	CGTCTC	2 cut(s)	117, 615
FaqI	GGGAC	1 cut(s)	765
FbaI	TGATCA	1 cut(s)	430
Fnu4HI	GCNGC	1 cut(s)	975
FokI	GGATG	4 cut(s)	17, 58, 440, 559
Fsp4HI	GCNGC	1 cut(s)	975
FspBI	CTAG	1 cut(s)	942
GluI	GCNGC	1 cut(s)	975
GsuI	CTGGAG	1 cut(s)	457
HaeIII	GGCC	1 cut(s)	708
HapII	CCGG	1 cut(s)	774
HinfI	GANTC	6 cut(s)	461, 598, 737, 887, 1072, 1198
HpaII	CCGG	1 cut(s)	774
HphI	GGTGA	2 cut(s)	422, 689
Hpy188I	TCNGA	7 cut(s)	112, 190, 610, 688, 892, 1086, 1132
Hpy188III	TCNNGA	3 cut(s)	389, 847, 1254
Hpy99I	CGWCG	5 cut(s)	93, 96, 171, 594, 597
HpyAV	CCTTC	1 cut(s)	1188
HpyCH4III	ACNGT	1 cut(s)	683
HpyCH4IV	ACGT	7 cut(s)	126, 145, 204, 568, 624, 643, 1280
HpyCH4V	TGCA	5 cut(s)	304, 325, 405, 1040, 1051
HpyF3I	CTNAG	1 cut(s)	1083
HpySE526I	ACGT	7 cut(s)	126, 145, 204, 568, 624, 643, 1280
Ksp22I	TGATCA	1 cut(s)	430
Kzo9I	GATC	5 cut(s)	73, 151, 175, 430, 649
LmnI	GCTCC	3 cut(s)	438, 491, 730
LpnPI	CCDG	8 cut(s)	308, 333, 363, 421, 676, 787, 799, 1239
LweI	GCATC	5 cut(s)	24, 36, 537, 588, 663
MaeI	CTAG	1 cut(s)	942
MaeII	ACGT	7 cut(s)	126, 145, 204, 568, 624, 643, 1280
MaeIII	GTNAC	6 cut(s)	127, 205, 512, 625, 677, 1078
MalI	GATC	5 cut(s)	75, 153, 177, 432, 651
MboI	GATC	5 cut(s)	73, 151, 175, 430, 649
MboII	GAAGA	5 cut(s)	495, 758, 896, 971, 1255
MfeI	CAATTG	2 cut(s)	256, 378
MhlI	GDGCHC	1 cut(s)	727
MlyI	GAGTC	2 cut(s)	607, 746
MmeI	TCCRAC	3 cut(s)	711, 1009, 1110
MnlI	CCTC	5 cut(s)	89, 499, 742, 805, 907
Mph1103I	ATGCAT	3 cut(s)	407, 1042, 1053
MroXI	GAANNNNTTC	1 cut(s)	936
MslI	CAYNNNNRTG	4 cut(s)	144, 222, 642, 720
MspI	CCGG	1 cut(s)	774
MunI	CAATTG	2 cut(s)	256, 378
Mva1269I	GAATGC	1 cut(s)	1040
NcoI	CCATGG	1 cut(s)	1238
NdeII	GATC	5 cut(s)	73, 151, 175, 430, 649
NlaIV	GGNNCC	1 cut(s)	685
NmuCI	GTSAC	3 cut(s)	512, 677, 1078
NsiI	ATGCAT	3 cut(s)	407, 1042, 1053
NspV	TTCGAA	1 cut(s)	499
PagI	TCATGA	2 cut(s)	388, 846
PcsI	WCGNNNNNNNCGW	4 cut(s)	97, 156, 175, 598
PctI	GAATGC	1 cut(s)	1040
PdmI	GAANNNNTTC	1 cut(s)	936
PfeI	GAWTC	4 cut(s)	461, 887, 1072, 1198
PflFI	GACNNNGTC	3 cut(s)	96, 597, 1249
PflMI	CCANNNNNTGG	1 cut(s)	361
PkrI	GCNGC	1 cut(s)	976
PleI	GAGTC	2 cut(s)	606, 745
PpsI	GAGTC	2 cut(s)	606, 745
Ppu21I	YACGTR	1 cut(s)	569
PshBI	ATTAAT	1 cut(s)	396
Psp1406I	AACGTT	1 cut(s)	204
PspN4I	GGNNCC	1 cut(s)	685
PspPI	GGNCC	2 cut(s)	707, 916
PsyI	GACNNNGTC	3 cut(s)	96, 597, 1249
RsaI	GTAC	3 cut(s)	66, 567, 760
RsaNI	GTAC	3 cut(s)	65, 566, 759
RseI	CAYNNNNRTG	4 cut(s)	144, 222, 642, 720
SatI	GCNGC	1 cut(s)	975
Sau3AI	GATC	5 cut(s)	73, 151, 175, 430, 649
Sau96I	GGNCC	2 cut(s)	707, 916
ScaI	AGTACT	1 cut(s)	760
SchI	GAGTC	2 cut(s)	607, 746
SduI	GDGCHC	1 cut(s)	727
SfaNI	GCATC	5 cut(s)	24, 36, 537, 588, 663
SfuI	TTCGAA	1 cut(s)	499
SinI	GGWCC	1 cut(s)	916
SmiMI	CAYNNNNRTG	4 cut(s)	144, 222, 642, 720
SmlI	CTYRAG	1 cut(s)	471
SmoI	CTYRAG	1 cut(s)	471
SnaBI	TACGTA	1 cut(s)	569
SsiI	CCGC	4 cut(s)	62, 563, 728, 975
SspI	AATATT	2 cut(s)	990, 1273
SspMI	CTAG	1 cut(s)	942
StyI	CCWWGG	1 cut(s)	1238
TaaI	ACNGT	1 cut(s)	683
TaiI	ACGT	7 cut(s)	129, 148, 207, 571, 627, 646, 1283
TaqI	TCGA	9 cut(s)	72, 88, 150, 159, 166, 499, 582, 589, 657
TatI	WGTACW	1 cut(s)	758
TauI	GCSGC	1 cut(s)	977
TfiI	GAWTC	4 cut(s)	461, 887, 1072, 1198
TscAI	CASTG	2 cut(s)	327, 440
TseFI	GTSAC	3 cut(s)	512, 677, 1078
Tsp45I	GTSAC	3 cut(s)	512, 677, 1078
TspGWI	ACGGA	1 cut(s)	610
TspRI	CASTG	2 cut(s)	327, 440
Tth111I	GACNNNGTC	3 cut(s)	96, 597, 1249
Van91I	CCANNNNNTGG	1 cut(s)	361
VpaK11BI	GGWCC	1 cut(s)	916
VspI	ATTAAT	1 cut(s)	396
XapI	RAATTY	4 cut(s)	932, 1013, 1105, 1139
XmnI	GAANNNNTTC	1 cut(s)	936
XspI	CTAG	1 cut(s)	942
ZrmI	AGTACT	1 cut(s)	760
Zsp2I	ATGCAT	3 cut(s)	407, 1042, 1053

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.