Rmu_sc0006592.1_g000013

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006592.1
OG0001043
Physical Location & Seq
Forward (+)
55467 .. 55886
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006592.1_g000013.1.cds

Sequence Viewer

Length: 420 bp
atggagggtcgtcatagcaacgacatggaggaaatcaagaagacaattcaacaacttgtagaacgtatcaatcgcattgaaactcaacaccaaggaggtaagacttgcaacagggagagacatgtttatcagcgtgtcacttgcatcgaaacctcatgccaagacggtgagtgttccgacaaggagagaaacatttatcagcgtgtcacttgcatcgaaacctcataccaagatggtgagtgtttcgacggggagggagacgttggccattttcatcactgtgctatgttgtgtgagtcgaaagaaaaggtggaaccggttagtttcgactataaaggttcaaatactatctttaacttttcagttaatgttgtaaatattaatgtggctattcatgtaatagcaattagtgttgggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

139

Amino Acids

15.87

Weight (kDa)

5.45

Isoelectric Point (pI)

42.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 265
AflIII ACRYGT 1 cut(s) 121
AgeI ACCGGT 1 cut(s) 316
AgsI TTSAA 3 cut(s) 50, 80, 342
Alw26I GTCTC 2 cut(s) 112, 252
AoxI GGCC 1 cut(s) 265
AseI ATTAAT 1 cut(s) 381
AsiGI ACCGGT 1 cut(s) 316
AsuHPI GGTGA 2 cut(s) 179, 248
BalI TGGCCA 1 cut(s) 267
BbsI GAAGAC 1 cut(s) 47
BccI CCATC 1 cut(s) 227
BcoDI GTCTC 2 cut(s) 112, 252
BmiI GGNNCC 1 cut(s) 315
BmsI GCATC 2 cut(s) 153, 222
BpiI GAAGAC 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 91
BsaWI WCCGGW 1 cut(s) 316
Bse118I RCCGGY 1 cut(s) 316
BseDI CCNNGG 1 cut(s) 91
BshFI GGCC 1 cut(s) 267
BshTI ACCGGT 1 cut(s) 316
BsiSI CCGG 1 cut(s) 317
BsmAI GTCTC 2 cut(s) 112, 252
BsmBI CGTCTC 1 cut(s) 252
BsnI GGCC 1 cut(s) 267
BspANI GGCC 1 cut(s) 267
BspLI GGNNCC 1 cut(s) 315
BsrFI RCCGGY 1 cut(s) 316
BssAI RCCGGY 1 cut(s) 316
BssECI CCNNGG 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 91
Bst4CI ACNGT 2 cut(s) 167, 281
BstMAI GTCTC 2 cut(s) 112, 252
BstNSI RCATGY 1 cut(s) 125
BstV2I GAAGAC 1 cut(s) 47
BsuRI GGCC 1 cut(s) 267
BtsIMutI CAGTG 1 cut(s) 277
Cfr10I RCCGGY 1 cut(s) 316
CspAI ACCGGT 1 cut(s) 316
CviAII CATG 4 cut(s) 25, 122, 156, 395
CviJI RGCY 2 cut(s) 267, 389
CviKI_1 RGCY 2 cut(s) 267, 389
EaeI YGGCCR 1 cut(s) 265
Eco130I CCWWGG 1 cut(s) 91
EcoT14I CCWWGG 1 cut(s) 91
ErhI CCWWGG 1 cut(s) 91
Esp3I CGTCTC 1 cut(s) 252
FaeI CATG 4 cut(s) 28, 125, 159, 398
FaiI YATR 8 cut(s) 15, 26, 123, 157, 226, 287, 333, 396
FatI CATG 4 cut(s) 24, 121, 155, 394
HaeIII GGCC 1 cut(s) 267
HapII CCGG 1 cut(s) 317
Hin1II CATG 4 cut(s) 28, 125, 159, 398
HinfI GANTC 1 cut(s) 296
HpaII CCGG 1 cut(s) 317
HphI GGTGA 2 cut(s) 179, 248
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 251
HpyCH4III ACNGT 2 cut(s) 167, 281
HpyCH4IV ACGT 2 cut(s) 64, 261
HpyCH4V TGCA 3 cut(s) 108, 144, 213
HpySE526I ACGT 2 cut(s) 64, 261
Hsp92II CATG 4 cut(s) 28, 125, 159, 398
LpnPI CCDG 2 cut(s) 97, 330
LweI GCATC 2 cut(s) 153, 222
MaeII ACGT 2 cut(s) 64, 261
MaeIII GTNAC 2 cut(s) 136, 205
MboII GAAGA 1 cut(s) 52
MlsI TGGCCA 1 cut(s) 267
MluCI AATT 2 cut(s) 45, 405
MluNI TGGCCA 1 cut(s) 267
MlyI GAGTC 1 cut(s) 305
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 5 cut(s) 22, 89, 163, 232, 247
Mox20I TGGCCA 1 cut(s) 267
MscI TGGCCA 1 cut(s) 267
MseI TTAA 3 cut(s) 354, 366, 381
MslI CAYNNNNRTG 1 cut(s) 279
Msp20I TGGCCA 1 cut(s) 267
MspI CCGG 1 cut(s) 317
NlaIII CATG 4 cut(s) 28, 125, 159, 398
NlaIV GGNNCC 1 cut(s) 315
NmuCI GTSAC 2 cut(s) 136, 205
NspI RCATGY 1 cut(s) 125
PciI ACATGT 1 cut(s) 121
PinAI ACCGGT 1 cut(s) 316
PleI GAGTC 1 cut(s) 304
PpsI GAGTC 1 cut(s) 304
PscI ACATGT 1 cut(s) 121
PshBI ATTAAT 1 cut(s) 381
PspN4I GGNNCC 1 cut(s) 315
RseI CAYNNNNRTG 1 cut(s) 279
SaqAI TTAA 3 cut(s) 354, 366, 381
SchI GAGTC 1 cut(s) 305
SetI ASST 7 cut(s) 67, 100, 155, 224, 264, 312, 340
SfaNI GCATC 2 cut(s) 153, 222
SmiMI CAYNNNNRTG 1 cut(s) 279
Sse9I AATT 2 cut(s) 45, 405
SspI AATATT 1 cut(s) 379
StyI CCWWGG 1 cut(s) 91
TaaI ACNGT 2 cut(s) 167, 281
TaiI ACGT 2 cut(s) 67, 264
TaqI TCGA 5 cut(s) 147, 216, 246, 299, 327
TasI AATT 2 cut(s) 45, 405
Tru1I TTAA 3 cut(s) 354, 366, 381
Tru9I TTAA 3 cut(s) 354, 366, 381
TscAI CASTG 1 cut(s) 284
TseFI GTSAC 2 cut(s) 136, 205
Tsp45I GTSAC 2 cut(s) 136, 205
TspDTI ATGAA 2 cut(s) 263, 383
TspRI CASTG 1 cut(s) 284
VspI ATTAAT 1 cut(s) 381
XceI RCATGY 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.