Rmu_sc0000516.1_g000018

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000516.1
OG0001043
Physical Location & Seq
Forward (+)
69853 .. 70494
642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000516.1_g000018.1.cds

Sequence Viewer

Length: 642 bp
atggagggtcatggcatcaacaacgacatggctgaaattaaaaggatgcttcaacaacttgcagtacttatcgatcgcattgaagctcgacgacgaggtcgtaagagttctgactgggagagagacgttaccacttatcatcaacgtgtcgatcacatcgaaactcgacgacgagattgtaagatttccgacggggagagaaacgttaccacctatcatcaatgtgtcaatcgctttgaagtttcacaccaaagcagtgagagtattgaggaggaacaagacattgaactctctcatcgctgtgcttctttgtgtgagccagatatacagaatgaaggtatgaacacatttaacgattttggtatatcaagttcttcttcagattcattgaacttggatatgccgccactttttgataattataattctgaagattgcgatgaaaattgcttggagattgaagcgtttgacctgcccatgcaaaggaattatctcccagtgcaacaaaatatagttaaagccatgccagtccatcttgtggaaacatcatcagcaattgtaagtcatgaaattaattcatgcatgggtgatatctttgaattggatgatcactgggtaattcagatccaaagctcaaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

213

Amino Acids

24.62

Weight (kDa)

4.63

Isoelectric Point (pI)

73.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 423
AasI GACNNNNNNGTC 1 cut(s) 96
Acc36I ACCTGC 1 cut(s) 480
AccB7I CCANNNNNTGG 1 cut(s) 538
AciI CCGC 1 cut(s) 404
AclI AACGTT 1 cut(s) 204
AclWI GGATC 1 cut(s) 619
AcuI CTGAAG 2 cut(s) 363, 450
AfaI GTAC 1 cut(s) 66
AfiI CCNNNNNNNGG 2 cut(s) 483, 538
AflIII ACRYGT 1 cut(s) 145
AgsI TTSAA 7 cut(s) 53, 83, 239, 287, 391, 461, 599
AluBI AGCT 2 cut(s) 86, 633
AluI AGCT 2 cut(s) 86, 633
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 619
AseI ATTAAT 1 cut(s) 573
AsuHPI GGTGA 1 cut(s) 599
BccI CCATC 1 cut(s) 540
BclI TGATCA 1 cut(s) 607
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 1 cut(s) 640
BfuAI ACCTGC 1 cut(s) 480
BisI GCNGC 1 cut(s) 404
BlsI GCNGC 1 cut(s) 405
BmcAI AGTACT 1 cut(s) 66
BmrI ACTGGG 3 cut(s) 124, 491, 622
BmsI GCATC 2 cut(s) 24, 36
BmuI ACTGGG 3 cut(s) 124, 491, 622
Bsa29I ATCGAT 1 cut(s) 72
Bsc4I CCNNNNNNNGG 2 cut(s) 483, 538
Bse1I ACTGG 4 cut(s) 119, 497, 527, 617
BseCI ATCGAT 1 cut(s) 72
BseGI GGATG 2 cut(s) 51, 610
BseLI CCNNNNNNNGG 2 cut(s) 483, 538
BseNI ACTGG 4 cut(s) 119, 497, 527, 617
BseRI GAGGAG 1 cut(s) 284
Bsh1285I CGRYCG 1 cut(s) 76
BshVI ATCGAT 1 cut(s) 72
BsiEI CGRYCG 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 483, 538
BsmAI GTCTC 1 cut(s) 117
BsmBI CGTCTC 1 cut(s) 117
Bsp143I GATC 4 cut(s) 73, 151, 607, 624
BspACI CCGC 1 cut(s) 404
BspDI ATCGAT 1 cut(s) 72
BspHI TCATGA 1 cut(s) 565
BspMI ACCTGC 1 cut(s) 480
BspPI GGATC 1 cut(s) 619
BsrI ACTGG 4 cut(s) 119, 497, 527, 617
BssMI GATC 4 cut(s) 73, 151, 607, 624
BstF5I GGATG 2 cut(s) 51, 610
BstKTI GATC 4 cut(s) 76, 154, 610, 627
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 4 cut(s) 73, 151, 607, 624
BstMCI CGRYCG 1 cut(s) 76
BstX2I RGATCY 1 cut(s) 624
BstYI RGATCY 1 cut(s) 624
Bsu15I ATCGAT 1 cut(s) 72
BsuTUI ATCGAT 1 cut(s) 72
BtgZI GCGATG 2 cut(s) 281, 453
BtsCI GGATG 2 cut(s) 51, 610
BtsI GCAGTG 1 cut(s) 262
BtsIMutI CAGTG 3 cut(s) 262, 504, 610
BveI ACCTGC 1 cut(s) 480
CciI TCATGA 1 cut(s) 565
ClaI ATCGAT 1 cut(s) 72
Csp6I GTAC 1 cut(s) 65
CviAII CATG 7 cut(s) 11, 28, 478, 523, 566, 579, 583
CviJI RGCY 5 cut(s) 32, 86, 319, 521, 633
CviKI_1 RGCY 5 cut(s) 32, 86, 319, 521, 633
CviQI GTAC 1 cut(s) 65
DpnI GATC 4 cut(s) 75, 153, 609, 626
DpnII GATC 4 cut(s) 73, 151, 607, 624
DrdI GACNNNNNNGTC 1 cut(s) 96
DseDI GACNNNNNNGTC 1 cut(s) 96
Eco32I GATATC 1 cut(s) 592
Eco57I CTGAAG 2 cut(s) 363, 450
EcoRV GATATC 1 cut(s) 592
EcoT22I ATGCAT 1 cut(s) 584
Esp3I CGTCTC 1 cut(s) 117
FaeI CATG 7 cut(s) 14, 31, 481, 526, 569, 582, 586
FalI AAGNNNNNCTT 2 cut(s) 361, 393
FatI CATG 7 cut(s) 10, 27, 477, 522, 565, 578, 582
FbaI TGATCA 1 cut(s) 607
Fnu4HI GCNGC 1 cut(s) 404
FokI GGATG 2 cut(s) 58, 617
Fsp4HI GCNGC 1 cut(s) 404
FspBI CTAG 1 cut(s) 640
GluI GCNGC 1 cut(s) 404
Hin1II CATG 7 cut(s) 14, 31, 481, 526, 569, 582, 586
HinfI GANTC 1 cut(s) 383
HphI GGTGA 1 cut(s) 599
Hpy188I TCNGA 5 cut(s) 112, 190, 382, 430, 624
Hpy188III TCNNGA 1 cut(s) 566
Hpy99I CGWCG 5 cut(s) 93, 96, 171, 174, 194
HpyAV CCTTC 1 cut(s) 329
HpyCH4IV ACGT 3 cut(s) 126, 145, 204
HpyCH4V TGCA 4 cut(s) 62, 481, 502, 582
HpySE526I ACGT 3 cut(s) 126, 145, 204
Hsp92II CATG 7 cut(s) 14, 31, 481, 526, 569, 582, 586
Ksp22I TGATCA 1 cut(s) 607
Kzo9I GATC 4 cut(s) 73, 151, 607, 624
LpnPI CCDG 6 cut(s) 100, 333, 485, 510, 540, 598
LweI GCATC 2 cut(s) 24, 36
MaeI CTAG 1 cut(s) 640
MaeII ACGT 3 cut(s) 126, 145, 204
MaeIII GTNAC 2 cut(s) 127, 205
MalI GATC 4 cut(s) 75, 153, 609, 626
MboI GATC 4 cut(s) 73, 151, 607, 624
MboII GAAGA 3 cut(s) 366, 369, 443
MfeI CAATTG 1 cut(s) 555
MflI RGATCY 1 cut(s) 624
MmeI TCCRAC 1 cut(s) 213
MnlI CCTC 3 cut(s) 89, 262, 265
Mph1103I ATGCAT 1 cut(s) 584
MseI TTAA 4 cut(s) 39, 351, 516, 573
MslI CAYNNNNRTG 3 cut(s) 144, 222, 300
MunI CAATTG 1 cut(s) 555
NdeII GATC 4 cut(s) 73, 151, 607, 624
NlaIII CATG 7 cut(s) 14, 31, 481, 526, 569, 582, 586
NsiI ATGCAT 1 cut(s) 584
PagI TCATGA 1 cut(s) 565
PcsI WCGNNNNNNNCGW 2 cut(s) 97, 156
PfeI GAWTC 1 cut(s) 383
PflFI GACNNNGTC 1 cut(s) 96
PflMI CCANNNNNTGG 1 cut(s) 538
PkrI GCNGC 1 cut(s) 405
Ple19I CGATCG 1 cut(s) 76
PshBI ATTAAT 1 cut(s) 573
PsiI TTATAA 1 cut(s) 423
Psp1406I AACGTT 1 cut(s) 204
PsrI GAACNNNNNNTAC 2 cut(s) 355, 387
PsuI RGATCY 1 cut(s) 624
PsyI GACNNNGTC 1 cut(s) 96
PvuI CGATCG 1 cut(s) 76
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
RseI CAYNNNNRTG 3 cut(s) 144, 222, 300
SaqAI TTAA 4 cut(s) 39, 351, 516, 573
SatI GCNGC 1 cut(s) 404
Sau3AI GATC 4 cut(s) 73, 151, 607, 624
ScaI AGTACT 1 cut(s) 66
SetI ASST 9 cut(s) 88, 100, 129, 148, 207, 215, 340, 474, 635
SfaNI GCATC 2 cut(s) 24, 36
SmiMI CAYNNNNRTG 3 cut(s) 144, 222, 300
SsiI CCGC 1 cut(s) 404
SspMI CTAG 1 cut(s) 640
TaiI ACGT 3 cut(s) 129, 148, 207
TaqI TCGA 5 cut(s) 72, 88, 150, 159, 166
TatI WGTACW 1 cut(s) 64
TauI GCSGC 1 cut(s) 406
TfiI GAWTC 1 cut(s) 383
Tru1I TTAA 4 cut(s) 39, 351, 516, 573
Tru9I TTAA 4 cut(s) 39, 351, 516, 573
TscAI CASTG 3 cut(s) 262, 504, 617
TspDTI ATGAA 6 cut(s) 348, 356, 375, 456, 567, 582
TspRI CASTG 3 cut(s) 262, 504, 617
Tth111I GACNNNGTC 1 cut(s) 96
Van91I CCANNNNNTGG 1 cut(s) 538
VspI ATTAAT 1 cut(s) 573
XspI CTAG 1 cut(s) 640
ZrmI AGTACT 1 cut(s) 66
Zsp2I ATGCAT 1 cut(s) 584
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.