Rh3CG198400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0001043
Physical Location & Seq
Forward (+)
17736180 .. 17736410
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG198400.1

Sequence Viewer

Length: 231 bp
ATGGAATTGGTGCAAGTTGATCAACCTTTGGACGTTGATAATGGTTTTGCCCTTCTCAATGTGAATAAGGTGATTAATATATCTCCAACTAAGAAGAGGGAAAGACCAAAAGGTAGTAAGAGCAAGACTAATGGGCATAAATCTAGGAAAACTAGGTTTCCATGCAAGGATGCGGTGGAGGTTGCTGGTGAGGTGGCTGCAGTGATAGCAAAGGATGAAAATTCAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.35

Weight (kDa)

9.46

Isoelectric Point (pI)

26.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 173
AcsI RAATTY 1 cut(s) 220
AgsI TTSAA 1 cut(s) 225
ApeKI GCWGC 1 cut(s) 197
ApoI RAATTY 1 cut(s) 220
AseI ATTAAT 1 cut(s) 75
AsuHPI GGTGA 2 cut(s) 82, 200
BbvI GCAGC 1 cut(s) 184
BclI TGATCA 1 cut(s) 19
BfaI CTAG 2 cut(s) 144, 153
BfmI CTRYAG 1 cut(s) 198
BisI GCNGC 1 cut(s) 198
BlsI GCNGC 1 cut(s) 199
BmsI GCATC 1 cut(s) 160
BseGI GGATG 2 cut(s) 175, 220
BseXI GCAGC 1 cut(s) 184
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 173
BspMAI CTGCAG 1 cut(s) 202
BssMI GATC 1 cut(s) 19
Bst6I CTCTTC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 2 cut(s) 175, 220
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstSFI CTRYAG 1 cut(s) 198
BstV1I GCAGC 1 cut(s) 184
BtsCI GGATG 2 cut(s) 175, 220
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 207
CviAII CATG 1 cut(s) 162
CviJI RGCY 1 cut(s) 197
CviKI_1 RGCY 1 cut(s) 197
DdeI CTNAG 1 cut(s) 90
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
FaeI CATG 1 cut(s) 165
FaiI YATR 3 cut(s) 80, 138, 163
FatI CATG 1 cut(s) 161
FbaI TGATCA 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 198
FokI GGATG 2 cut(s) 182, 227
Fsp4HI GCNGC 1 cut(s) 198
FspBI CTAG 2 cut(s) 144, 153
GluI GCNGC 1 cut(s) 198
Hin1II CATG 1 cut(s) 165
HphI GGTGA 2 cut(s) 82, 200
HpyAV CCTTC 1 cut(s) 62
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 3 cut(s) 13, 165, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 33
Hsp92II CATG 1 cut(s) 165
Ksp22I TGATCA 1 cut(s) 19
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 1 cut(s) 171
Lsp1109I GCAGC 1 cut(s) 184
LweI GCATC 1 cut(s) 160
MaeI CTAG 2 cut(s) 144, 153
MaeII ACGT 1 cut(s) 33
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 1 cut(s) 106
MluCI AATT 2 cut(s) 5, 220
MmeI TCCRAC 1 cut(s) 110
MnlI CCTC 3 cut(s) 90, 172, 184
MseI TTAA 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 206
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 165
PkrI GCNGC 1 cut(s) 199
PshBI ATTAAT 1 cut(s) 75
PstI CTGCAG 1 cut(s) 202
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 198
Sau3AI GATC 1 cut(s) 19
SetI ASST 7 cut(s) 28, 36, 72, 115, 158, 183, 195
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 198
SgeI CNNG 7 cut(s) 26, 136, 156, 165, 174, 178, 198
Sse9I AATT 2 cut(s) 5, 220
SsiI CCGC 1 cut(s) 173
SspMI CTAG 2 cut(s) 144, 153
TaiI ACGT 1 cut(s) 36
TasI AATT 2 cut(s) 5, 220
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 207
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 231
TspRI CASTG 1 cut(s) 207
VspI ATTAAT 1 cut(s) 75
XapI RAATTY 1 cut(s) 220
XspI CTAG 2 cut(s) 144, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.