Prupe.5G011800_v2.0.a1

Serine threonine-protein kinase PBS1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0000508
Physical Location & Seq
Reverse (-)
1227673 .. 1230234
2562 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G011800.1

Sequence Viewer

Length: 792 bp
ATGAGGCCCACTTCAGAATCAGCAGAGTGGATATTTTTAGCCACTAACCTTGGCCTAGAGATGTTGTCAGCTGCTTGTGATCAGGCTTCCTCCCCAAGAAGACCCCACTTTGCACTATTTGGGATGCTGTTGGCAATTGCAGCTGTGTTCATTTCCATCGGGGAGCTAGTTTACAGAGGTAAAAGGGAAAGAGTTGTGTTGAGGAGACGGGGAATGCTCTGGTGGTTTTATCATCCACCACCTCCTCGACATGCGCCTTTTGGTACTCTTCCTGACATTTATGGAGTAGTTGCTGGCATCTCACAGTGCATTTGCTCTATAGTTCAGTATGTTTACTGCCTTCGGCATGCTGATAGTCCTTTCAAAGCATCCCTTTTGCCTGCCATATTTCTTATCTGTTTAGTTGGTTCAAGACTAAGTAATAAGCGAATGAACGCCAATACTTCAAGCGTGGAAGAAACTTCGTTGCATCCAATCCAGGAGTATTATGCACCTGCCAATATACCATTTGTCGATAATCAGGAGGTAGAGGTTGAGGACAATATAGTTGGTTACCAGCAACAAGTGATGGAGCCGCTGCTGGAGCCGCAGTTGGACATGCGGTATCTGAAGAAGCTGCAGTATCTGGACCTGTCACAGCTGCGGTATCTGGACCTGTCACAGCTGCGGTATCTGGACCTGTCACAGCTGCGGTATCTGGAGCTGGGACTGCAGCTGCTCCCGCATCTACCTCAACTGCCACATCTGCAGTATCTGGACCTGCCGCAGCAGTTGCGGCCAAAGGAAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

264

Amino Acids

30.24

Weight (kDa)

6.39

Isoelectric Point (pI)

61.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000508)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g06570 FvH4_2g06640 FvH4_2g14130 FvH4_2g14140 FvH4_2g14140 FvH4_2g36090 FvH4_2g36090 FvH4_2g36100
malus_domestica MD11G1218200.v1.1 MD15G1057100.v1.1 MD15G1057200.v1.1
prunus_persica Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.4G127700_v2.0.a1 Prupe.5G011700_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012400_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.8G119700_v2.0.a1 Prupe.8G119700_v2.0.a1
pyrus_communis pycom02g13080 pycom05g07020 pycom15g05370 pycom15g05380
rosa_chinensis RchiOBHm_Chr1g0372601 RchiOBHm_Chr6g0258611 RchiOBHm_Chr6g0276221 RchiOBHm_Chr6g0276231 RchiOBHm_Chr6g0276251 RchiOBHm_Chr6g0276271 RchiOBHm_Chr6g0276281 RchiOBHm_Chr6g0276291
rosa_laevigata RLG00000013406 RLG00000013407 RLG00000013408 RLG00000013617
rosa_multiflora Rmu_sc0001663.1_g000017 Rmu_sc0003665.1_g000003 Rmu_sc0004048.1_g000003 Rmu_sc0004048.1_g000006 Rmu_sc0004048.1_g000008 Rmu_sc0004049.1_g000006 Rmu_sc0004049.1_g000008 Rmu_sc0004049.1_g000010 Rmu_ssc0000213.1_g000005
rosa_roxburghii Rroxscaffold_178G00437490 Rroxscaffold_7G00192430 Rroxscaffold_7G00192440 Rroxscaffold_7G00192480 Rroxscaffold_7G00205750
rosa_rugosa Rorug05G0581900 Rorug05G0582500 Rorug06G0074900 Rorug06G0099400 Rorug06G0099600
rosa_samantha Rh6AG098600 Rh6AG190000 Rh6AG210800 Rh6AG210900 Rh6BG090400 Rh6BG193400 Rh6BG215000 Rh6BG215100 Rh6CG087300 Rh6DG081500 Rh6DG184600 Rh6DG207700
rosa_wichuraiana Rw6G008540 Rw6G018370 Rw6G018380 Rw6G018410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 502
Acc36I ACCTGC 2 cut(s) 502, 768
AciI CCGC 9 cut(s) 575, 587, 601, 643, 667, 691, 722, 764, 775
AcoI YGGCCR 1 cut(s) 776
AcuI CTGAAG 1 cut(s) 629
AfaI GTAC 1 cut(s) 265
AgsI TTSAA 3 cut(s) 364, 411, 447
AjnI CCWGG 1 cut(s) 477
AluBI AGCT 9 cut(s) 71, 143, 166, 616, 640, 664, 688, 703, 715
AluI AGCT 9 cut(s) 71, 143, 166, 616, 640, 664, 688, 703, 715
Alw26I GTCTC 1 cut(s) 199
AlwNI CAGNNNCTG 2 cut(s) 625, 754
AoxI GGCC 3 cut(s) 5, 52, 776
AspLEI GCGC 1 cut(s) 256
AspS9I GGNCC 5 cut(s) 6, 628, 652, 676, 757
AvaII GGWCC 4 cut(s) 628, 652, 676, 757
BbsI GAAGAC 1 cut(s) 106
BccI CCATC 2 cut(s) 164, 562
BciT130I CCWGG 1 cut(s) 479
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 199
BfaI CTAG 2 cut(s) 56, 167
BfmI CTRYAG 4 cut(s) 318, 617, 710, 746
BfuAI ACCTGC 2 cut(s) 502, 768
Bme1390I CCNGG 1 cut(s) 479
Bme18I GGWCC 4 cut(s) 628, 652, 676, 757
BmgT120I GGNCC 5 cut(s) 6, 628, 652, 676, 757
BmiI GGNNCC 2 cut(s) 573, 585
BmrFI CCNGG 1 cut(s) 479
BmsI GCATC 5 cut(s) 114, 306, 377, 478, 733
BpiI GAAGAC 1 cut(s) 106
BpmI CTGGAG 2 cut(s) 602, 719
BsaJI CCNNGG 1 cut(s) 49
BsaXI ACNNNNNCTCC 2 cut(s) 575, 605
BseBI CCWGG 1 cut(s) 479
BseDI CCNNGG 1 cut(s) 49
BseGI GGATG 4 cut(s) 129, 232, 368, 469
BseRI GAGGAG 2 cut(s) 217, 234
BseYI CCCAGC 1 cut(s) 703
BshFI GGCC 3 cut(s) 7, 54, 778
BslFI GGGAC 1 cut(s) 720
BsmAI GTCTC 1 cut(s) 199
BsmBI CGTCTC 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 720
BsmI GAATGC 1 cut(s) 219
BsnI GGCC 3 cut(s) 7, 54, 778
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 9 cut(s) 575, 587, 601, 643, 667, 691, 722, 764, 775
BspANI GGCC 3 cut(s) 7, 54, 778
BspLI GGNNCC 2 cut(s) 573, 585
BspMAI CTGCAG 3 cut(s) 621, 714, 750
BspMI ACCTGC 2 cut(s) 502, 768
BssECI CCNNGG 1 cut(s) 49
BssMI GATC 1 cut(s) 79
BssT1I CCWWGG 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 479
Bst4CI ACNGT 1 cut(s) 306
Bst6I CTCTTC 1 cut(s) 273
BstAPI GCANNNNNTGC 1 cut(s) 772
BstC8I GCNNGC 3 cut(s) 295, 348, 381
BstDEI CTNAG 1 cut(s) 416
BstEII GGTNACC 1 cut(s) 551
BstF5I GGATG 4 cut(s) 129, 232, 368, 469
BstHHI GCGC 1 cut(s) 256
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 8 cut(s) 140, 583, 586, 709, 721, 745, 772, 775
BstNI CCWGG 1 cut(s) 479
BstNSI RCATGY 3 cut(s) 254, 350, 601
BstPI GGTNACC 1 cut(s) 551
BstSCI CCNGG 1 cut(s) 477
BstSFI CTRYAG 4 cut(s) 318, 617, 710, 746
BstV2I GAAGAC 1 cut(s) 106
BsuRI GGCC 3 cut(s) 7, 54, 778
BtsCI GGATG 4 cut(s) 129, 232, 368, 469
BtsIMutI CAGTG 1 cut(s) 311
BveI ACCTGC 2 cut(s) 502, 768
Cac8I GCNNGC 3 cut(s) 295, 348, 381
CaiI CAGNNNCTG 2 cut(s) 625, 754
CfoI GCGC 1 cut(s) 256
Cfr13I GGNCC 5 cut(s) 6, 628, 652, 676, 757
Csp6I GTAC 1 cut(s) 264
CspCI CAANNNNNGTGG 2 cut(s) 31, 66
CviAII CATG 3 cut(s) 251, 347, 598
CviQI GTAC 1 cut(s) 264
DdeI CTNAG 1 cut(s) 416
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
EaeI YGGCCR 1 cut(s) 776
Eam1104I CTCTTC 1 cut(s) 273
EarI CTCTTC 1 cut(s) 273
Eco130I CCWWGG 1 cut(s) 49
Eco47I GGWCC 4 cut(s) 628, 652, 676, 757
Eco57I CTGAAG 1 cut(s) 629
Eco91I GGTNACC 1 cut(s) 551
EcoO65I GGTNACC 1 cut(s) 551
EcoRII CCWGG 1 cut(s) 477
EcoT14I CCWWGG 1 cut(s) 49
ErhI CCWWGG 1 cut(s) 49
Esp3I CGTCTC 1 cut(s) 199
FaeI CATG 3 cut(s) 254, 350, 601
FalI AAGNNNNNCTT 2 cut(s) 357, 389
FaqI GGGAC 1 cut(s) 720
FatI CATG 3 cut(s) 250, 346, 597
FauI CCCGC 1 cut(s) 729
FbaI TGATCA 1 cut(s) 79
FokI GGATG 4 cut(s) 136, 219, 355, 456
FspBI CTAG 2 cut(s) 56, 167
GlaI GCGC 1 cut(s) 255
GsaI CCCAGC 1 cut(s) 707
GsuI CTGGAG 2 cut(s) 602, 719
HaeIII GGCC 3 cut(s) 7, 54, 778
HhaI GCGC 1 cut(s) 256
Hin1II CATG 3 cut(s) 254, 350, 601
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HinfI GANTC 1 cut(s) 17
Hpy166II GTNNAC 2 cut(s) 172, 334
Hpy188I TCNGA 2 cut(s) 16, 609
Hpy188III TCNNGA 8 cut(s) 272, 411, 521, 626, 650, 674, 698, 755
Hpy8I GTNNAC 2 cut(s) 172, 334
HpyAV CCTTC 1 cut(s) 350
HpyCH4III ACNGT 1 cut(s) 306
HpyCH4V TGCA 8 cut(s) 113, 140, 309, 469, 491, 619, 712, 748
HpyF10VI GCNNNNNNNGC 8 cut(s) 140, 583, 586, 709, 721, 745, 772, 775
HpyF3I CTNAG 1 cut(s) 416
Hsp92II CATG 3 cut(s) 254, 350, 601
HspAI GCGC 1 cut(s) 254
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 5 cut(s) 163, 571, 583, 700, 723
LweI GCATC 5 cut(s) 114, 306, 377, 478, 733
MaeI CTAG 2 cut(s) 56, 167
MaeIII GTNAC 4 cut(s) 551, 633, 657, 681
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 4 cut(s) 111, 260, 467, 622
MfeI CAATTG 1 cut(s) 135
MluCI AATT 1 cut(s) 135
MmeI TCCRAC 1 cut(s) 573
MnlI CCTC 9 cut(s) 100, 170, 195, 252, 255, 517, 523, 529, 741
MspA1I CMGCKG 7 cut(s) 71, 143, 577, 640, 664, 688, 715
MspR9I CCNGG 1 cut(s) 479
MunI CAATTG 1 cut(s) 135
Mva1269I GAATGC 1 cut(s) 219
MvaI CCWGG 1 cut(s) 479
MwoI GCNNNNNNNGC 8 cut(s) 140, 583, 586, 709, 721, 745, 772, 775
NdeII GATC 1 cut(s) 79
NlaIII CATG 3 cut(s) 254, 350, 601
NlaIV GGNNCC 2 cut(s) 573, 585
NmuCI GTSAC 3 cut(s) 633, 657, 681
NspI RCATGY 3 cut(s) 254, 350, 601
PaeI GCATGC 1 cut(s) 350
PaqCI CACCTGC 1 cut(s) 502
PctI GAATGC 1 cut(s) 219
PfeI GAWTC 1 cut(s) 17
PfoI TCCNGGA 1 cut(s) 477
Psp6I CCWGG 1 cut(s) 477
PspEI GGTNACC 1 cut(s) 551
PspFI CCCAGC 1 cut(s) 703
PspGI CCWGG 1 cut(s) 477
PspN4I GGNNCC 2 cut(s) 573, 585
PspPI GGNCC 5 cut(s) 6, 628, 652, 676, 757
PstI CTGCAG 3 cut(s) 621, 714, 750
PstNI CAGNNNCTG 2 cut(s) 625, 754
PvuII CAGCTG 6 cut(s) 71, 143, 640, 664, 688, 715
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 5 cut(s) 6, 628, 652, 676, 757
ScrFI CCNGG 1 cut(s) 479
SfaNI GCATC 5 cut(s) 114, 306, 377, 478, 733
SfcI CTRYAG 4 cut(s) 318, 617, 710, 746
SinI GGWCC 4 cut(s) 628, 652, 676, 757
SphI GCATGC 1 cut(s) 350
Sse9I AATT 1 cut(s) 135
SsiI CCGC 9 cut(s) 575, 587, 601, 643, 667, 691, 722, 764, 775
SspMI CTAG 2 cut(s) 56, 167
StyD4I CCNGG 1 cut(s) 477
StyI CCWWGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 306
TaqI TCGA 2 cut(s) 247, 513
TasI AATT 1 cut(s) 135
TauI GCSGC 4 cut(s) 577, 589, 766, 778
TfiI GAWTC 1 cut(s) 17
TscAI CASTG 1 cut(s) 311
TseFI GTSAC 3 cut(s) 633, 657, 681
Tsp45I GTSAC 3 cut(s) 633, 657, 681
TspDTI ATGAA 2 cut(s) 139, 446
TspRI CASTG 1 cut(s) 311
VpaK11BI GGWCC 4 cut(s) 628, 652, 676, 757
XceI RCATGY 3 cut(s) 254, 350, 601
XspI CTAG 2 cut(s) 56, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.