Rh6AG210800

Serine threonine-protein kinase PBS1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000508
Physical Location & Seq
Reverse (-)
37559716 .. 37560045
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG210800.1

Sequence Viewer

Length: 330 bp
ATGTTTGTTTGCATTTGGGAGCTCATTCACAAGGGCATCAATGAAAAAGTAGTATTGAAGAAGTTTGGAAAGCTATGGTGGTATTATTATCCAGACCCCCACGAAAGCACGCCTTTTGGTACTCTCCCTGACATTTATGGACTAATTGGGGGAATTTCTCAGTGTATATGCTCCATAACTCAATATGCTTACTTCTCTTGGCATGCTGATAGTCCCATAAAACTATCCCTTTTACCTACCATCTTTCTTTTGTGTTTGGCCGGTTCAAGACTAAATAGAAATCGAAACCATGGTCAGACTGTTGGACCTAAATCCCTAGACAAAGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.48

Weight (kDa)

8.71

Isoelectric Point (pI)

29.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000508)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g06570 FvH4_2g06640 FvH4_2g14130 FvH4_2g14140 FvH4_2g14140 FvH4_2g36090 FvH4_2g36090 FvH4_2g36100
malus_domestica MD11G1218200.v1.1 MD15G1057100.v1.1 MD15G1057200.v1.1
prunus_persica Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.4G127700_v2.0.a1 Prupe.5G011700_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012400_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.8G119700_v2.0.a1 Prupe.8G119700_v2.0.a1
pyrus_communis pycom02g13080 pycom05g07020 pycom15g05370 pycom15g05380
rosa_chinensis RchiOBHm_Chr1g0372601 RchiOBHm_Chr6g0258611 RchiOBHm_Chr6g0276221 RchiOBHm_Chr6g0276231 RchiOBHm_Chr6g0276251 RchiOBHm_Chr6g0276271 RchiOBHm_Chr6g0276281 RchiOBHm_Chr6g0276291
rosa_laevigata RLG00000013406 RLG00000013407 RLG00000013408 RLG00000013617
rosa_multiflora Rmu_sc0001663.1_g000017 Rmu_sc0003665.1_g000003 Rmu_sc0004048.1_g000003 Rmu_sc0004048.1_g000006 Rmu_sc0004048.1_g000008 Rmu_sc0004049.1_g000006 Rmu_sc0004049.1_g000008 Rmu_sc0004049.1_g000010 Rmu_ssc0000213.1_g000005
rosa_roxburghii Rroxscaffold_178G00437490 Rroxscaffold_7G00192430 Rroxscaffold_7G00192440 Rroxscaffold_7G00192480 Rroxscaffold_7G00205750
rosa_rugosa Rorug05G0581900 Rorug05G0582500 Rorug06G0074900 Rorug06G0099400 Rorug06G0099600
rosa_samantha Rh6AG098600 Rh6AG190000 Rh6AG210800 Rh6AG210900 Rh6BG090400 Rh6BG193400 Rh6BG215000 Rh6BG215100 Rh6CG087300 Rh6DG081500 Rh6DG184600 Rh6DG207700
rosa_wichuraiana Rw6G008540 Rw6G018370 Rw6G018380 Rw6G018410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 258
AcsI RAATTY 1 cut(s) 153
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 2 cut(s) 58, 267
AluBI AGCT 2 cut(s) 22, 73
AluI AGCT 2 cut(s) 22, 73
Alw21I GWGCWC 1 cut(s) 24
AoxI GGCC 1 cut(s) 258
ApoI RAATTY 1 cut(s) 153
ArsI GACNNNNNNTTYG 2 cut(s) 277, 309
AspS9I GGNCC 1 cut(s) 305
AvaII GGWCC 1 cut(s) 305
BanII GRGCYC 1 cut(s) 24
Bbv12I GWGCWC 1 cut(s) 24
BccI CCATC 1 cut(s) 248
BfaI CTAG 1 cut(s) 317
Bme18I GGWCC 1 cut(s) 305
BmgT120I GGNCC 1 cut(s) 305
BmsI GCATC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 289
Bse118I RCCGGY 1 cut(s) 260
BseDI CCNNGG 1 cut(s) 289
BseMII CTCAG 1 cut(s) 173
BshFI GGCC 1 cut(s) 260
BsiHKAI GWGCWC 1 cut(s) 24
BsiSI CCGG 1 cut(s) 261
BslFI GGGAC 1 cut(s) 198
BsmFI GGGAC 1 cut(s) 198
BsnI GGCC 1 cut(s) 260
Bsp1286I GDGCHC 1 cut(s) 24
Bsp19I CCATGG 1 cut(s) 289
BspANI GGCC 1 cut(s) 260
BspCNI CTCAG 1 cut(s) 172
BsrFI RCCGGY 1 cut(s) 260
BssAI RCCGGY 1 cut(s) 260
BssECI CCNNGG 1 cut(s) 289
BssT1I CCWWGG 1 cut(s) 289
Bst4CI ACNGT 1 cut(s) 301
BstC8I GCNNGC 2 cut(s) 110, 204
BstDEI CTNAG 1 cut(s) 159
BstDSI CCRYGG 1 cut(s) 289
BstNSI RCATGY 1 cut(s) 206
BsuRI GGCC 1 cut(s) 260
BtgI CCRYGG 1 cut(s) 289
BtsIMutI CAGTG 1 cut(s) 167
Cac8I GCNNGC 2 cut(s) 110, 204
Cfr10I RCCGGY 1 cut(s) 260
Cfr13I GGNCC 1 cut(s) 305
Csp6I GTAC 1 cut(s) 120
CviAII CATG 2 cut(s) 203, 290
CviJI RGCY 3 cut(s) 22, 73, 260
CviKI_1 RGCY 3 cut(s) 22, 73, 260
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 159
EaeI YGGCCR 1 cut(s) 258
Ecl136II GAGCTC 1 cut(s) 22
Eco130I CCWWGG 1 cut(s) 289
Eco24I GRGCYC 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 305
Eco53kI GAGCTC 1 cut(s) 22
EcoICRI GAGCTC 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 289
EcoT38I GRGCYC 1 cut(s) 24
ErhI CCWWGG 1 cut(s) 289
FaeI CATG 2 cut(s) 206, 293
FaiI YATR 9 cut(s) 76, 138, 167, 169, 176, 186, 204, 218, 291
FalI AAGNNNNNCTT 2 cut(s) 97, 129
FaqI GGGAC 1 cut(s) 198
FatI CATG 2 cut(s) 202, 289
FriOI GRGCYC 1 cut(s) 24
FspBI CTAG 1 cut(s) 317
HaeIII GGCC 1 cut(s) 260
HapII CCGG 1 cut(s) 261
Hin1II CATG 2 cut(s) 206, 293
HpaII CCGG 1 cut(s) 261
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 2 cut(s) 92, 267
HpyCH4III ACNGT 1 cut(s) 301
HpyCH4V TGCA 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 2 cut(s) 206, 293
LmnI GCTCC 2 cut(s) 19, 176
LpnPI CCDG 3 cut(s) 105, 141, 274
LweI GCATC 1 cut(s) 45
MaeI CTAG 1 cut(s) 317
MboII GAAGA 1 cut(s) 70
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 2 cut(s) 144, 153
MmeI TCCRAC 1 cut(s) 283
MspI CCGG 1 cut(s) 261
NcoI CCATGG 1 cut(s) 289
NlaIII CATG 2 cut(s) 206, 293
NspI RCATGY 1 cut(s) 206
PaeI GCATGC 1 cut(s) 206
Psp124BI GAGCTC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 305
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SacI GAGCTC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 305
SduI GDGCHC 1 cut(s) 24
SetI ASST 4 cut(s) 24, 75, 238, 310
SfaNI GCATC 1 cut(s) 45
SinI GGWCC 1 cut(s) 305
SphI GCATGC 1 cut(s) 206
Sse9I AATT 2 cut(s) 144, 153
SspMI CTAG 1 cut(s) 317
SstI GAGCTC 1 cut(s) 24
StyI CCWWGG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 301
TaqI TCGA 1 cut(s) 283
TasI AATT 2 cut(s) 144, 153
TscAI CASTG 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 305
XapI RAATTY 1 cut(s) 153
XceI RCATGY 1 cut(s) 206
XspI CTAG 1 cut(s) 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.