Rh6BG215000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0000508
Physical Location & Seq
Reverse (-)
40563296 .. 40573856
10561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG215000.1

Sequence Viewer

Length: 276 bp
ATGGAAGGGATGCAAGTCTGTCTGAAGCTACCTTATACTGAAGCACATATGATCAAGATGGGGCTACAGAAGAATGAAGTACAGGTTATAGAAGAAATTACTGAAGCACTGTGGAACAAACTACATTCTAGACTCAGTCCAACGGAAAAACTGCACCCGACGCCCACACACAACTTGGTCGCATTCACTAGCATTAGTGTTAATGAGGACCACCGTGACCATAACCATCCAATAAACATTACAGATGTGACGGTAAAAACTCAGAATTATAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.47

Weight (kDa)

6.12

Isoelectric Point (pI)

52.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000508)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g06570 FvH4_2g06640 FvH4_2g14130 FvH4_2g14140 FvH4_2g14140 FvH4_2g36090 FvH4_2g36090 FvH4_2g36100
malus_domestica MD11G1218200.v1.1 MD15G1057100.v1.1 MD15G1057200.v1.1
prunus_persica Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.1G197200_v2.0.a1 Prupe.4G127700_v2.0.a1 Prupe.5G011700_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G011800_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012300_v2.0.a1 Prupe.5G012400_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012500_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.5G012700_v2.0.a1 Prupe.8G119700_v2.0.a1 Prupe.8G119700_v2.0.a1
pyrus_communis pycom02g13080 pycom05g07020 pycom15g05370 pycom15g05380
rosa_chinensis RchiOBHm_Chr1g0372601 RchiOBHm_Chr6g0258611 RchiOBHm_Chr6g0276221 RchiOBHm_Chr6g0276231 RchiOBHm_Chr6g0276251 RchiOBHm_Chr6g0276271 RchiOBHm_Chr6g0276281 RchiOBHm_Chr6g0276291
rosa_laevigata RLG00000013406 RLG00000013407 RLG00000013408 RLG00000013617
rosa_multiflora Rmu_sc0001663.1_g000017 Rmu_sc0003665.1_g000003 Rmu_sc0004048.1_g000003 Rmu_sc0004048.1_g000006 Rmu_sc0004048.1_g000008 Rmu_sc0004049.1_g000006 Rmu_sc0004049.1_g000008 Rmu_sc0004049.1_g000010 Rmu_ssc0000213.1_g000005
rosa_roxburghii Rroxscaffold_178G00437490 Rroxscaffold_7G00192430 Rroxscaffold_7G00192440 Rroxscaffold_7G00192480 Rroxscaffold_7G00205750
rosa_rugosa Rorug05G0581900 Rorug05G0582500 Rorug06G0074900 Rorug06G0099400 Rorug06G0099600
rosa_samantha Rh6AG098600 Rh6AG190000 Rh6AG210800 Rh6AG210900 Rh6BG090400 Rh6BG193400 Rh6BG215000 Rh6BG215100 Rh6CG087300 Rh6DG081500 Rh6DG184600 Rh6DG207700
rosa_wichuraiana Rw6G008540 Rw6G018370 Rw6G018380 Rw6G018410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 3 cut(s) 44, 60, 123
AcyI GRCGYC 1 cut(s) 161
AfaI GTAC 1 cut(s) 81
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 208
AvaII GGWCC 1 cut(s) 208
BccI CCATC 2 cut(s) 52, 234
BclI TGATCA 1 cut(s) 51
BfaI CTAG 2 cut(s) 129, 189
BfmI CTRYAG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 208
BmgT120I GGNCC 1 cut(s) 208
BsaHI GRCGYC 1 cut(s) 161
BseGI GGATG 2 cut(s) 15, 226
BseMII CTCAG 2 cut(s) 148, 275
BsgI GTGCAG 1 cut(s) 137
BsmI GAATGC 1 cut(s) 182
Bsp143I GATC 1 cut(s) 51
BspCNI CTCAG 2 cut(s) 147, 274
BssMI GATC 1 cut(s) 51
BssNI GRCGYC 1 cut(s) 161
Bst4CI ACNGT 3 cut(s) 111, 215, 253
BstACI GRCGYC 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 134, 261
BstF5I GGATG 2 cut(s) 15, 226
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 160
BstSFI CTRYAG 1 cut(s) 65
BtsCI GGATG 2 cut(s) 15, 226
BtsIMutI CAGTG 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 208
CseI GACGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 80
CviJI RGCY 2 cut(s) 28, 64
CviKI_1 RGCY 2 cut(s) 28, 64
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 2 cut(s) 134, 261
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 208
Eco57I CTGAAG 3 cut(s) 44, 60, 123
FaiI YATR 6 cut(s) 36, 48, 50, 89, 222, 270
FauNDI CATATG 1 cut(s) 48
FbaI TGATCA 1 cut(s) 51
FokI GGATG 2 cut(s) 22, 213
FspBI CTAG 2 cut(s) 129, 189
HgaI GACGC 1 cut(s) 169
Hin1I GRCGYC 1 cut(s) 161
HinfI GANTC 1 cut(s) 132
Hpy188I TCNGA 2 cut(s) 24, 264
Hpy188III TCNNGA 2 cut(s) 55, 129
Hpy99I CGWCG 1 cut(s) 163
HpyCH4III ACNGT 3 cut(s) 111, 215, 253
HpyCH4V TGCA 2 cut(s) 13, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 160
HpyF3I CTNAG 2 cut(s) 134, 261
Hsp92I GRCGYC 1 cut(s) 161
Ksp22I TGATCA 1 cut(s) 51
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 1 cut(s) 68
MaeI CTAG 2 cut(s) 129, 189
MaeIII GTNAC 2 cut(s) 215, 247
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 2 cut(s) 82, 104
MluCI AATT 2 cut(s) 96, 265
MlyI GAGTC 1 cut(s) 126
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 1 cut(s) 199
MseI TTAA 2 cut(s) 201, 274
Mva1269I GAATGC 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 160
NdeI CATATG 1 cut(s) 48
NdeII GATC 1 cut(s) 51
NmuCI GTSAC 2 cut(s) 215, 247
PctI GAATGC 1 cut(s) 182
PflFI GACNNNGTC 1 cut(s) 135
PleI GAGTC 1 cut(s) 126
PpsI GAGTC 1 cut(s) 126
PspPI GGNCC 1 cut(s) 208
PsyI GACNNNGTC 1 cut(s) 135
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 2 cut(s) 201, 274
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 208
SchI GAGTC 1 cut(s) 126
SetI ASST 3 cut(s) 30, 34, 87
SfcI CTRYAG 1 cut(s) 65
SgeI CNNG 8 cut(s) 26, 67, 95, 141, 169, 187, 201, 227
SinI GGWCC 1 cut(s) 208
Sse9I AATT 2 cut(s) 96, 265
SspMI CTAG 2 cut(s) 129, 189
TaaI ACNGT 3 cut(s) 111, 215, 253
TasI AATT 2 cut(s) 96, 265
TatI WGTACW 1 cut(s) 79
Tru1I TTAA 2 cut(s) 201, 274
Tru9I TTAA 2 cut(s) 201, 274
TscAI CASTG 1 cut(s) 114
TseFI GTSAC 2 cut(s) 215, 247
Tsp45I GTSAC 2 cut(s) 215, 247
TspDTI ATGAA 1 cut(s) 90
TspGWI ACGGA 1 cut(s) 158
TspRI CASTG 1 cut(s) 114
Tth111I GACNNNGTC 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 208
XbaI TCTAGA 1 cut(s) 128
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
XspI CTAG 2 cut(s) 129, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.