pycom01g00760

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
740902 .. 741579
678 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00760.2

Sequence Viewer

Length: 543 bp
ATGCCTCAAGTCAAAAGACTAATTTGCATTATCCCAACCATGAGTTCTCATTCTCTATTGAGCAGCTACGTACTTGTCTTGATTGCACCACCAATTCAACACATGCACCCATCACCTAACACAAATCCTCTAATCCGTGCATTCCCTTTTGCATTCCAGCCACTCCACATTCATCACCAACACAATCATCAACAAAAGACCCATTCCTACCCATGCCGTGCATCCCCTCACCAAGAAATCATTGCACATGCACATTCACCCTCTTCTCCCATCCTTGACCCACATATTCACCCACATGCACTCCCATCCCATTTCCAGCTTTCCACCAACAACCTAGCTGTCATATTCCCTCGTTTAATCATTCATCCACCTATAAATAAACATCCATTGCAGCCACAAGAGAGGGGATTCATTCATTCATCATTCATACACCAGAAATCATCCTTGCCGTGCCTTCCTCCACCACTCCCCATCCATTCATACACACACCCTACCATTACACAACCATTCCCCACTCCATTCCACATACACCTAAAGCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

181

Amino Acids

20.44

Weight (kDa)

9.85

Isoelectric Point (pI)

74.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 72
AgsI TTSAA 1 cut(s) 98
AjuI GAANNNNNNNTTGG 2 cut(s) 28, 60
AluBI AGCT 3 cut(s) 66, 319, 338
AluI AGCT 3 cut(s) 66, 319, 338
ApeKI GCWGC 2 cut(s) 63, 391
AsuHPI GGTGA 5 cut(s) 105, 167, 221, 249, 281
BbvI GCAGC 2 cut(s) 75, 403
BccI CCATC 4 cut(s) 118, 278, 313, 479
BceAI ACGGC 2 cut(s) 201, 433
BfaI CTAG 1 cut(s) 335
BisI GCNGC 2 cut(s) 64, 392
BlsI GCNGC 2 cut(s) 65, 393
BmsI GCATC 1 cut(s) 230
BsaAI YACGTR 1 cut(s) 70
BsaXI ACNNNNNCTCC 2 cut(s) 285, 315
Bse3DI GCAATG 2 cut(s) 240, 386
BseGI GGATG 7 cut(s) 221, 270, 305, 364, 382, 440, 471
BseMI GCAATG 2 cut(s) 240, 386
BseXI GCAGC 2 cut(s) 75, 403
BsmI GAATGC 2 cut(s) 140, 152
BsrDI GCAATG 2 cut(s) 240, 386
Bst6I CTCTTC 1 cut(s) 268
BstBAI YACGTR 1 cut(s) 70
BstF5I GGATG 7 cut(s) 221, 270, 305, 364, 382, 440, 471
BstNSI RCATGY 3 cut(s) 106, 251, 299
BstSNI TACGTA 1 cut(s) 70
BstV1I GCAGC 2 cut(s) 75, 403
BtsCI GGATG 7 cut(s) 221, 270, 305, 364, 382, 440, 471
Csp6I GTAC 1 cut(s) 71
CviAII CATG 5 cut(s) 40, 103, 213, 248, 296
CviJI RGCY 6 cut(s) 66, 160, 319, 338, 394, 538
CviKI_1 RGCY 6 cut(s) 66, 160, 319, 338, 394, 538
CviQI GTAC 1 cut(s) 71
Eam1104I CTCTTC 1 cut(s) 268
EarI CTCTTC 1 cut(s) 268
Eco105I TACGTA 1 cut(s) 70
FaeI CATG 5 cut(s) 43, 106, 216, 251, 299
FatI CATG 5 cut(s) 39, 102, 212, 247, 295
Fnu4HI GCNGC 2 cut(s) 64, 392
FokI GGATG 7 cut(s) 208, 257, 292, 351, 369, 427, 458
Fsp4HI GCNGC 2 cut(s) 64, 392
FspBI CTAG 1 cut(s) 335
GluI GCNGC 2 cut(s) 64, 392
Hin1II CATG 5 cut(s) 43, 106, 216, 251, 299
HinfI GANTC 1 cut(s) 408
HphI GGTGA 5 cut(s) 105, 167, 221, 249, 281
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 464
HpyCH4IV ACGT 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 5 cut(s) 43, 106, 216, 251, 299
LpnPI CCDG 3 cut(s) 170, 329, 446
Lsp1109I GCAGC 2 cut(s) 75, 403
LweI GCATC 1 cut(s) 230
MaeI CTAG 1 cut(s) 335
MaeII ACGT 1 cut(s) 69
MboII GAAGA 1 cut(s) 255
MluCI AATT 2 cut(s) 21, 93
MnlI CCTC 7 cut(s) 15, 138, 237, 271, 360, 396, 468
MseI TTAA 1 cut(s) 356
MslI CAYNNNNRTG 1 cut(s) 294
Mva1269I GAATGC 2 cut(s) 140, 152
NlaIII CATG 5 cut(s) 43, 106, 216, 251, 299
NspI RCATGY 3 cut(s) 106, 251, 299
PctI GAATGC 2 cut(s) 140, 152
PfeI GAWTC 1 cut(s) 408
PkrI GCNGC 2 cut(s) 65, 393
Ppu21I YACGTR 1 cut(s) 70
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 1 cut(s) 356
SatI GCNGC 2 cut(s) 64, 392
SetI ASST 8 cut(s) 68, 72, 118, 321, 336, 340, 373, 534
SfaNI GCATC 1 cut(s) 230
SmiMI CAYNNNNRTG 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
SnaBI TACGTA 1 cut(s) 70
Sse9I AATT 2 cut(s) 21, 93
SspMI CTAG 1 cut(s) 335
TaiI ACGT 1 cut(s) 72
TasI AATT 2 cut(s) 21, 93
TfiI GAWTC 1 cut(s) 408
Tru1I TTAA 1 cut(s) 356
Tru9I TTAA 1 cut(s) 356
TseI GCWGC 2 cut(s) 63, 391
TspDTI ATGAA 7 cut(s) 161, 353, 400, 404, 408, 415, 468
TspGWI ACGGA 1 cut(s) 125
XceI RCATGY 3 cut(s) 106, 251, 299
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.