Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012419

Orthogroup ID

OG0001078

Physical Location & Seq

Genomic Coordinates Forward (+)

115212 .. 115466

Gene Structure 255 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12419g00090.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

ATGCACTTTGGACATAAAACAAAGGGCCTAGCCCAATCAAACTATCCTTTGAGCCATGCAAAACCTCTAGCCCAATCAACAACCCTTAGCCACATGCATTCACATGCATCACAACCCCAAAACCATCAAGAAACACCATTCACACACACATGCACTTACCCTTTCATCATTGCACCACCATTCACACACACATGCACTTACTCCTTCATCATTACACCACCTTCTCCATCTTTATTCCACATGCATTCATCATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

85

Amino Acids

9.41

Weight (kDa)

8.75

Isoelectric Point (pI)

84.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001078)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g00180 pycom01g00760 pycom01g00800 pycom01g01160 pycom01g01410 pycom01g01510 pycom01g02680 pycom01g03660 pycom01g04490 pycom01g04590 pycom05g07480 pycom05g08240 pycom06g05520 pycom08g21300 pycom09g14500 pycom09g15620 pycom1217g00030 pycom12419g00090 pycom12426g00110 pycom12426g00280 pycom12426g00360 pycom12426g00410 pycom12463g00050 pycom12550g00010 pycom12646g00150 pycom12661g00040 pycom12g01970 pycom13g25610 pycom13g26290 pycom13g26550 pycom13g27610 pycom13g28380 pycom15g26800 pycom15g27340 pycom17g16540 pycom17g16580 pycom17g17460 pycom17g17480 pycom17g17860 pycom17g17950 pycom1844g00090 pycom1844g00120 pycom1880g00090 pycom2167g00020 pycom2246g00140 pycom2328g00050 pycom2328g00060 pycom266g00030 pycom280g00040 pycom436g00200 pycom520g00190 pycom520g00200 pycom520g00480 pycom520g00550 pycom520g01130 pycom808g00260 pycom808g00400 pycom808g00470 pycom889g00040 pycom889g00050

Species

Orthologous Gene IDs

pyrus_communis

pycom01g00180 pycom01g00760 pycom01g00800 pycom01g01160 pycom01g01410 pycom01g01510 pycom01g02680 pycom01g03660 pycom01g04490 pycom01g04590 pycom05g07480 pycom05g08240 pycom06g05520 pycom08g21300 pycom09g14500 pycom09g15620 pycom1217g00030 pycom12419g00090 pycom12426g00110 pycom12426g00280 pycom12426g00360 pycom12426g00410 pycom12463g00050 pycom12550g00010 pycom12646g00150 pycom12661g00040 pycom12g01970 pycom13g25610 pycom13g26290 pycom13g26550 pycom13g27610 pycom13g28380 pycom15g26800 pycom15g27340 pycom17g16540 pycom17g16580 pycom17g17460 pycom17g17480 pycom17g17860 pycom17g17950 pycom1844g00090 pycom1844g00120 pycom1880g00090 pycom2167g00020 pycom2246g00140 pycom2328g00050 pycom2328g00060 pycom266g00030 pycom280g00040 pycom436g00200 pycom520g00190 pycom520g00200 pycom520g00480 pycom520g00550 pycom520g01130 pycom808g00260 pycom808g00400 pycom808g00470 pycom889g00040 pycom889g00050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AoxI	GGCC	1 cut(s)	25
AspS9I	GGNCC	1 cut(s)	25
BccI	CCATC	2 cut(s)	132, 235
BfaI	CTAG	2 cut(s)	29, 68
BmgT120I	GGNCC	1 cut(s)	25
BmsI	GCATC	1 cut(s)	116
Bpu10I	CCTNAGC	1 cut(s)	86
Bse3DI	GCAATG	1 cut(s)	168
BseMI	GCAATG	1 cut(s)	168
BshFI	GGCC	1 cut(s)	27
BsmI	GAATGC	2 cut(s)	97, 244
BsnI	GGCC	1 cut(s)	27
BspANI	GGCC	1 cut(s)	27
BsrDI	GCAATG	1 cut(s)	168
BstDEI	CTNAG	1 cut(s)	86
BstNSI	RCATGY	5 cut(s)	97, 107, 153, 195, 244
BsuRI	GGCC	1 cut(s)	27
Cfr13I	GGNCC	1 cut(s)	25
CviAII	CATG	6 cut(s)	56, 94, 104, 150, 192, 241
CviJI	RGCY	5 cut(s)	27, 32, 54, 71, 90
CviKI_1	RGCY	5 cut(s)	27, 32, 54, 71, 90
DdeI	CTNAG	1 cut(s)	86
EcoO109I	RGGNCCY	1 cut(s)	25
EcoT22I	ATGCAT	3 cut(s)	99, 109, 246
FaeI	CATG	6 cut(s)	59, 97, 107, 153, 195, 244
FaiI	YATR	8 cut(s)	15, 57, 95, 105, 151, 193, 242, 253
FatI	CATG	6 cut(s)	55, 93, 103, 149, 191, 240
FspBI	CTAG	2 cut(s)	29, 68
HaeIII	GGCC	1 cut(s)	27
Hin1II	CATG	6 cut(s)	59, 97, 107, 153, 195, 244
Hpy188III	TCNNGA	1 cut(s)	128
HpyAV	CCTTC	2 cut(s)	214, 231
HpyCH4V	TGCA	8 cut(s)	4, 59, 97, 107, 153, 173, 195, 244
HpyF3I	CTNAG	1 cut(s)	86
Hsp92II	CATG	6 cut(s)	59, 97, 107, 153, 195, 244
LweI	GCATC	1 cut(s)	116
MaeI	CTAG	2 cut(s)	29, 68
MnlI	CCTC	1 cut(s)	75
Mph1103I	ATGCAT	3 cut(s)	99, 109, 246
MslI	CAYNNNNRTG	3 cut(s)	102, 148, 190
Mva1269I	GAATGC	2 cut(s)	97, 244
NlaIII	CATG	6 cut(s)	59, 97, 107, 153, 195, 244
NsiI	ATGCAT	3 cut(s)	99, 109, 246
NspI	RCATGY	5 cut(s)	97, 107, 153, 195, 244
PctI	GAATGC	2 cut(s)	97, 244
PspPI	GGNCC	1 cut(s)	25
RseI	CAYNNNNRTG	3 cut(s)	102, 148, 190
Sau96I	GGNCC	1 cut(s)	25
SetI	ASST	2 cut(s)	67, 223
SfaNI	GCATC	1 cut(s)	116
SgeI	CNNG	8 cut(s)	41, 68, 80, 106, 116, 140, 162, 204
SmiMI	CAYNNNNRTG	3 cut(s)	102, 148, 190
SspMI	CTAG	2 cut(s)	29, 68
TspDTI	ATGAA	3 cut(s)	154, 196, 237
XceI	RCATGY	5 cut(s)	97, 107, 153, 195, 244
XspI	CTAG	2 cut(s)	29, 68
Zsp2I	ATGCAT	3 cut(s)	99, 109, 246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.