pycom09g14500

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
14145667 .. 14146294
628 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g14500.2

Sequence Viewer

Length: 534 bp
ATGCACTTTGGACATAAAACAAAGGGCCTAGCCCAATCAAACAATCATTTGAGCCATGCAAAACCTCTAGCCCAATCAACAACCCTTAGCCACATGCATTCACATGCATCACAACCCCAAAACCATCATTCACCACCATTCACACACACATGCACTTACTCTTTCATCATTGCACCACCATTCACACACACATGCACTTACTCTTTCATCATTGCACCACCAATTCAACACATGCATTCACACACCAACAACGTAGCTCTTTTTCCATCATTATTTCATCCACATGCACTCTCAATCATAACAACCACATTCACTCTTAAACAATCACCCACATATTCTCCCATTCCCCCTATAAAAACCCATGCATTCATACACAAAAATCACATCTCATTCTCATACACAACACACCACAAACACATCCAATCTTCCCTTATAATCCAAACACCACTCCTCATCCATTTCCATAATTCCCCAATCCATTCAACACACCAACAACATCCCTTAGACCTTGTGCTACGACGAAGAGGAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

178

Amino Acids

20.13

Weight (kDa)

10.25

Isoelectric Point (pI)

74.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 434
AgsI TTSAA 2 cut(s) 227, 483
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
AoxI GGCC 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 25
AsuHPI GGTGA 2 cut(s) 123, 318
BccI CCATC 2 cut(s) 132, 274
BfaI CTAG 2 cut(s) 29, 68
BmgT120I GGNCC 1 cut(s) 25
BmsI GCATC 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 322, 352
Bse3DI GCAATG 2 cut(s) 168, 210
BseGI GGATG 4 cut(s) 277, 417, 453, 496
BseMI GCAATG 2 cut(s) 168, 210
BseRI GAGGAG 1 cut(s) 440
BshFI GGCC 1 cut(s) 27
BsmI GAATGC 3 cut(s) 97, 235, 365
BsnI GGCC 1 cut(s) 27
BspANI GGCC 1 cut(s) 27
BsrDI GCAATG 2 cut(s) 168, 210
Bst6I CTCTTC 1 cut(s) 517
BstDEI CTNAG 2 cut(s) 86, 502
BstF5I GGATG 4 cut(s) 277, 417, 453, 496
BstNSI RCATGY 6 cut(s) 97, 107, 153, 195, 235, 287
BsuRI GGCC 1 cut(s) 27
BtsCI GGATG 4 cut(s) 277, 417, 453, 496
Cfr13I GGNCC 1 cut(s) 25
CviAII CATG 8 cut(s) 56, 94, 104, 150, 192, 232, 284, 362
CviJI RGCY 6 cut(s) 27, 32, 54, 71, 90, 257
CviKI_1 RGCY 6 cut(s) 27, 32, 54, 71, 90, 257
DdeI CTNAG 2 cut(s) 86, 502
Eam1104I CTCTTC 1 cut(s) 517
EarI CTCTTC 1 cut(s) 517
EcoO109I RGGNCCY 1 cut(s) 25
EcoT22I ATGCAT 4 cut(s) 99, 109, 237, 367
FaeI CATG 8 cut(s) 59, 97, 107, 153, 195, 235, 287, 365
FatI CATG 8 cut(s) 55, 93, 103, 149, 191, 231, 283, 361
FokI GGATG 4 cut(s) 264, 404, 440, 483
FspBI CTAG 2 cut(s) 29, 68
HaeIII GGCC 1 cut(s) 27
Hin1II CATG 8 cut(s) 59, 97, 107, 153, 195, 235, 287, 365
HphI GGTGA 2 cut(s) 123, 318
Hpy99I CGWCG 1 cut(s) 522
HpyCH4IV ACGT 1 cut(s) 252
HpyF3I CTNAG 2 cut(s) 86, 502
HpySE526I ACGT 1 cut(s) 252
Hsp92II CATG 8 cut(s) 59, 97, 107, 153, 195, 235, 287, 365
LweI GCATC 1 cut(s) 116
MaeI CTAG 2 cut(s) 29, 68
MaeII ACGT 1 cut(s) 252
MboII GAAGA 2 cut(s) 417, 534
MluCI AATT 2 cut(s) 222, 466
MnlI CCTC 3 cut(s) 75, 461, 518
Mph1103I ATGCAT 4 cut(s) 99, 109, 237, 367
MseI TTAA 1 cut(s) 318
MslI CAYNNNNRTG 4 cut(s) 102, 148, 190, 282
Mva1269I GAATGC 3 cut(s) 97, 235, 365
NlaIII CATG 8 cut(s) 59, 97, 107, 153, 195, 235, 287, 365
NsiI ATGCAT 4 cut(s) 99, 109, 237, 367
NspI RCATGY 6 cut(s) 97, 107, 153, 195, 235, 287
PctI GAATGC 3 cut(s) 97, 235, 365
PsiI TTATAA 1 cut(s) 434
PspPI GGNCC 1 cut(s) 25
RseI CAYNNNNRTG 4 cut(s) 102, 148, 190, 282
SaqAI TTAA 1 cut(s) 318
Sau96I GGNCC 1 cut(s) 25
SetI ASST 4 cut(s) 67, 255, 259, 510
SfaNI GCATC 1 cut(s) 116
SmiMI CAYNNNNRTG 4 cut(s) 102, 148, 190, 282
Sse9I AATT 2 cut(s) 222, 466
SspMI CTAG 2 cut(s) 29, 68
TaiI ACGT 1 cut(s) 255
TasI AATT 2 cut(s) 222, 466
Tru1I TTAA 1 cut(s) 318
Tru9I TTAA 1 cut(s) 318
TspDTI ATGAA 4 cut(s) 154, 196, 266, 358
XceI RCATGY 6 cut(s) 97, 107, 153, 195, 235, 287
XspI CTAG 2 cut(s) 29, 68
Zsp2I ATGCAT 4 cut(s) 99, 109, 237, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.