pycom12661g00040

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012661
Physical Location & Seq
Forward (+)
34813 .. 35363
551 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12661g00040.2

Sequence Viewer

Length: 456 bp
ATGCTTGGAGCCAAAGTGTTGGACGAAATTGAAGACCTAATTGAAGACCAAAGTGTTGGAACCTTGTTCTCTTTAGTTTTAGGACATTTAAAACCTTTCCTAATCCTAATCATGCCATGCATAACACACATCCATTCTAACACATTGTCATTGCACATGCATTTCCTTCATTACATCACCACATATCATATCACTTATCACTTATCACTTAACATATCATCCACCTACTTCACCTACAACATCCACCTACTTCACCTACAACATCCACCTACTTCACCTACAAATGACATAGCCATATGTTCCCTCCACTACTCCTATAAATACCCTTGCATTCATTCATTCATGGACATCTCATTTTCATACACAACACACCACAAACACATCCCTTTCTCTCTTAGCCGTGATCCACACTTCCATCCCCCAAACCAATTATCCCTAGACCTTATGCTACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

17.53

Weight (kDa)

6.38

Isoelectric Point (pI)

63.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 398
AgsI TTSAA 2 cut(s) 32, 44
AlwI GGATC 1 cut(s) 398
AsuHPI GGTGA 4 cut(s) 169, 223, 245, 267
BbsI GAAGAC 2 cut(s) 39, 51
BccI CCATC 1 cut(s) 423
BceAI ACGGC 1 cut(s) 384
BfaI CTAG 1 cut(s) 437
BmiI GGNNCC 2 cut(s) 10, 61
BpiI GAAGAC 2 cut(s) 39, 51
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bse3DI GCAATG 1 cut(s) 149
BseGI GGATG 6 cut(s) 129, 218, 240, 262, 381, 415
BseMI GCAATG 1 cut(s) 149
BsmI GAATGC 1 cut(s) 330
Bsp143I GATC 1 cut(s) 403
BspLI GGNNCC 2 cut(s) 10, 61
BspPI GGATC 1 cut(s) 398
BsrDI GCAATG 1 cut(s) 149
BssMI GATC 1 cut(s) 403
BstDEI CTNAG 1 cut(s) 395
BstF5I GGATG 6 cut(s) 129, 218, 240, 262, 381, 415
BstKTI GATC 1 cut(s) 406
BstMBI GATC 1 cut(s) 403
BstNSI RCATGY 1 cut(s) 160
BstV2I GAAGAC 2 cut(s) 39, 51
BstXI CCANNNNNNTGG 2 cut(s) 19, 56
BtsCI GGATG 6 cut(s) 129, 218, 240, 262, 381, 415
CviAII CATG 4 cut(s) 112, 117, 157, 343
CviJI RGCY 3 cut(s) 11, 293, 399
CviKI_1 RGCY 3 cut(s) 11, 293, 399
DdeI CTNAG 1 cut(s) 395
DpnI GATC 1 cut(s) 405
DpnII GATC 1 cut(s) 403
DraI TTTAAA 1 cut(s) 90
EcoT22I ATGCAT 2 cut(s) 122, 162
FaeI CATG 4 cut(s) 115, 120, 160, 346
FatI CATG 4 cut(s) 111, 116, 156, 342
FauNDI CATATG 1 cut(s) 296
FokI GGATG 6 cut(s) 116, 205, 227, 249, 368, 402
FspBI CTAG 1 cut(s) 437
Hin1II CATG 4 cut(s) 115, 120, 160, 346
HphI GGTGA 4 cut(s) 169, 223, 245, 267
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 4 cut(s) 120, 154, 160, 330
HpyF3I CTNAG 1 cut(s) 395
Hsp92II CATG 4 cut(s) 115, 120, 160, 346
Kzo9I GATC 1 cut(s) 403
LmnI GCTCC 1 cut(s) 8
MaeI CTAG 1 cut(s) 437
MalI GATC 1 cut(s) 405
MboI GATC 1 cut(s) 403
MboII GAAGA 2 cut(s) 44, 56
MluCI AATT 3 cut(s) 27, 39, 428
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 314
Mph1103I ATGCAT 2 cut(s) 122, 162
MseI TTAA 2 cut(s) 89, 210
Mva1269I GAATGC 1 cut(s) 330
NdeI CATATG 1 cut(s) 296
NdeII GATC 1 cut(s) 403
NlaIII CATG 4 cut(s) 115, 120, 160, 346
NlaIV GGNNCC 2 cut(s) 10, 61
NsiI ATGCAT 2 cut(s) 122, 162
NspI RCATGY 1 cut(s) 160
PctI GAATGC 1 cut(s) 330
PspN4I GGNNCC 2 cut(s) 10, 61
SaqAI TTAA 2 cut(s) 89, 210
Sau3AI GATC 1 cut(s) 403
SgeI CNNG 9 cut(s) 17, 76, 124, 129, 169, 339, 355, 413, 449
Sse9I AATT 3 cut(s) 27, 39, 428
SspMI CTAG 1 cut(s) 437
TasI AATT 3 cut(s) 27, 39, 428
Tru1I TTAA 2 cut(s) 89, 210
Tru9I TTAA 2 cut(s) 89, 210
TspDTI ATGAA 5 cut(s) 158, 323, 327, 331, 348
XceI RCATGY 1 cut(s) 160
XspI CTAG 1 cut(s) 437
Zsp2I ATGCAT 2 cut(s) 122, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.