pycom12550g00010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012550
OG0001078
Physical Location & Seq
Forward (+)
45768 .. 46124
357 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12550g00010.1

Sequence Viewer

Length: 357 bp
ATGCACATTCACCTTGCTTTGCCGAAAATCCACTTCATAACACATGCATCTTGGCAGATTTCACATGCACTCATGCACATTCACCTTAATCATTCACATAGCTTTAATCCACATGCATTTCCACCTAGATTTCCACCTCACAACCACCAGAAATCAACCAAAAACGTGCATTCCCTTTCATTTCTGTCAAAACACATGCATTTCCACCCTTTAATCACATGCACAAACAGCCACATGCATCTCCCATCACCATTTCAGATTTCCACCAAGTTCCTAGCTGTCATGTTCCCCCATTTCACCTATAAATACTCATTCATTCATTCTCATTCATACACAATCCATTCACCACAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.9

Weight (kDa)

10.18

Isoelectric Point (pI)

64.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 102, 278
AluI AGCT 2 cut(s) 102, 278
AsuHPI GGTGA 4 cut(s) 74, 240, 289, 336
BccI CCATC 1 cut(s) 253
BfaI CTAG 2 cut(s) 126, 275
BmsI GCATC 2 cut(s) 56, 247
BsmI GAATGC 1 cut(s) 169
BstMWI GCNNNNNNNGC 1 cut(s) 228
BstNSI RCATGY 6 cut(s) 47, 68, 116, 199, 222, 238
CviAII CATG 8 cut(s) 44, 65, 73, 113, 196, 219, 235, 283
CviJI RGCY 3 cut(s) 102, 231, 278
CviKI_1 RGCY 3 cut(s) 102, 231, 278
EcoT22I ATGCAT 4 cut(s) 49, 118, 201, 240
FaeI CATG 8 cut(s) 47, 68, 76, 116, 199, 222, 238, 286
FatI CATG 8 cut(s) 43, 64, 72, 112, 195, 218, 234, 282
FspBI CTAG 2 cut(s) 126, 275
Hin1II CATG 8 cut(s) 47, 68, 76, 116, 199, 222, 238, 286
HphI GGTGA 4 cut(s) 74, 240, 289, 336
Hpy188I TCNGA 1 cut(s) 258
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 9 cut(s) 4, 47, 68, 76, 116, 169, 199, 222, 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 228
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 8 cut(s) 47, 68, 76, 116, 199, 222, 238, 286
LpnPI CCDG 1 cut(s) 161
LweI GCATC 2 cut(s) 56, 247
MaeI CTAG 2 cut(s) 126, 275
MaeII ACGT 1 cut(s) 165
MnlI CCTC 1 cut(s) 147
Mph1103I ATGCAT 4 cut(s) 49, 118, 201, 240
MseI TTAA 3 cut(s) 87, 105, 212
Mva1269I GAATGC 1 cut(s) 169
MwoI GCNNNNNNNGC 1 cut(s) 228
NlaIII CATG 8 cut(s) 47, 68, 76, 116, 199, 222, 238, 286
NsiI ATGCAT 4 cut(s) 49, 118, 201, 240
NspI RCATGY 6 cut(s) 47, 68, 116, 199, 222, 238
PctI GAATGC 1 cut(s) 169
SaqAI TTAA 3 cut(s) 87, 105, 212
SetI ASST 8 cut(s) 15, 87, 104, 127, 139, 168, 280, 302
SfaNI GCATC 2 cut(s) 56, 247
SspMI CTAG 2 cut(s) 126, 275
TaiI ACGT 1 cut(s) 168
Tru1I TTAA 3 cut(s) 87, 105, 212
Tru9I TTAA 3 cut(s) 87, 105, 212
TspDTI ATGAA 5 cut(s) 25, 168, 304, 308, 318
XceI RCATGY 6 cut(s) 47, 68, 116, 199, 222, 238
XspI CTAG 2 cut(s) 126, 275
Zsp2I ATGCAT 4 cut(s) 49, 118, 201, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.