Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr6

Orthogroup ID

OG0001078

Physical Location & Seq

Genomic Coordinates Forward (+)

8121914 .. 8122247

Gene Structure 334 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom06g05520.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGCAATTCTCCATCATTCCTCCACACAAACACCTTAAACAAATATCCCATCATTCAAAACATCTCATTCACAACACAACACCCCTCAAACACTTCCATTCTTTCCTTAGCCGTGAGTCCCCCCTCCCTACTAATCCAAACACCAACCATCTTTCCATTTCCATCACTCCTCACTCAATTCCACACTTCCATTCCCCCAAACCAACTATCCTTAGACCTTATGCTACAACAACGAGGAAGAGAAGAGGACCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

98

Amino Acids

11.24

Weight (kDa)

11.45

Isoelectric Point (pI)

57.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001078)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g00180 pycom01g00760 pycom01g00800 pycom01g01160 pycom01g01410 pycom01g01510 pycom01g02680 pycom01g03660 pycom01g04490 pycom01g04590 pycom05g07480 pycom05g08240 pycom06g05520 pycom08g21300 pycom09g14500 pycom09g15620 pycom1217g00030 pycom12419g00090 pycom12426g00110 pycom12426g00280 pycom12426g00360 pycom12426g00410 pycom12463g00050 pycom12550g00010 pycom12646g00150 pycom12661g00040 pycom12g01970 pycom13g25610 pycom13g26290 pycom13g26550 pycom13g27610 pycom13g28380 pycom15g26800 pycom15g27340 pycom17g16540 pycom17g16580 pycom17g17460 pycom17g17480 pycom17g17860 pycom17g17950 pycom1844g00090 pycom1844g00120 pycom1880g00090 pycom2167g00020 pycom2246g00140 pycom2328g00050 pycom2328g00060 pycom266g00030 pycom280g00040 pycom436g00200 pycom520g00190 pycom520g00200 pycom520g00480 pycom520g00550 pycom520g01130 pycom808g00260 pycom808g00400 pycom808g00470 pycom889g00040 pycom889g00050

Species

Orthologous Gene IDs

pyrus_communis

pycom01g00180 pycom01g00760 pycom01g00800 pycom01g01160 pycom01g01410 pycom01g01510 pycom01g02680 pycom01g03660 pycom01g04490 pycom01g04590 pycom05g07480 pycom05g08240 pycom06g05520 pycom08g21300 pycom09g14500 pycom09g15620 pycom1217g00030 pycom12419g00090 pycom12426g00110 pycom12426g00280 pycom12426g00360 pycom12426g00410 pycom12463g00050 pycom12550g00010 pycom12646g00150 pycom12661g00040 pycom12g01970 pycom13g25610 pycom13g26290 pycom13g26550 pycom13g27610 pycom13g28380 pycom15g26800 pycom15g27340 pycom17g16540 pycom17g16580 pycom17g17460 pycom17g17480 pycom17g17860 pycom17g17950 pycom1844g00090 pycom1844g00120 pycom1880g00090 pycom2167g00020 pycom2246g00140 pycom2328g00050 pycom2328g00060 pycom266g00030 pycom280g00040 pycom436g00200 pycom520g00190 pycom520g00200 pycom520g00480 pycom520g00550 pycom520g01130 pycom808g00260 pycom808g00400 pycom808g00470 pycom889g00040 pycom889g00050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	256
AgsI	TTSAA	2 cut(s)	57, 270
AspS9I	GGNCC	1 cut(s)	248
AvaII	GGWCC	1 cut(s)	248
BccI	CCATC	4 cut(s)	20, 57, 156, 170
BceAI	ACGGC	1 cut(s)	96
Bme18I	GGWCC	1 cut(s)	248
BmgT120I	GGNCC	1 cut(s)	248
Bpu10I	CCTNAGC	1 cut(s)	107
BseRI	GAGGAG	1 cut(s)	159
BslFI	GGGAC	1 cut(s)	103
BsmFI	GGGAC	1 cut(s)	103
Bst6I	CTCTTC	2 cut(s)	233, 238
BstDEI	CTNAG	2 cut(s)	107, 212
Cfr13I	GGNCC	1 cut(s)	248
CviJI	RGCY	1 cut(s)	111
CviKI_1	RGCY	1 cut(s)	111
DdeI	CTNAG	2 cut(s)	107, 212
Eam1104I	CTCTTC	2 cut(s)	233, 238
EarI	CTCTTC	2 cut(s)	233, 238
Eco47I	GGWCC	1 cut(s)	248
EcoO109I	RGGNCCY	1 cut(s)	248
FaiI	YATR	2 cut(s)	222, 262
FaqI	GGGAC	1 cut(s)	103
HinfI	GANTC	1 cut(s)	116
HpyCH4IV	ACGT	1 cut(s)	256
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	2 cut(s)	107, 212
HpySE526I	ACGT	1 cut(s)	256
MaeII	ACGT	1 cut(s)	256
MboII	GAAGA	2 cut(s)	250, 255
MluCI	AATT	3 cut(s)	5, 177, 265
MlyI	GAGTC	1 cut(s)	125
MmeI	TCCRAC	1 cut(s)	263
MnlI	CCTC	6 cut(s)	30, 95, 134, 180, 228, 239
MseI	TTAA	1 cut(s)	36
PleI	GAGTC	1 cut(s)	124
PpsI	GAGTC	1 cut(s)	124
PpuMI	RGGWCCY	1 cut(s)	248
Psp1406I	AACGTT	1 cut(s)	256
Psp5II	RGGWCCY	1 cut(s)	248
PspPI	GGNCC	1 cut(s)	248
PspPPI	RGGWCCY	1 cut(s)	248
SaqAI	TTAA	1 cut(s)	36
Sau96I	GGNCC	1 cut(s)	248
SchI	GAGTC	1 cut(s)	125
SetI	ASST	4 cut(s)	36, 220, 253, 259
SgeI	CNNG	3 cut(s)	125, 246, 282
SinI	GGWCC	1 cut(s)	248
Sse9I	AATT	3 cut(s)	5, 177, 265
TaiI	ACGT	1 cut(s)	259
TasI	AATT	3 cut(s)	5, 177, 265
Tru1I	TTAA	1 cut(s)	36
Tru9I	TTAA	1 cut(s)	36
TspDTI	ATGAA	1 cut(s)	249
VpaK11BI	GGWCC	1 cut(s)	248

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.