pycom15g27340

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
22709894 .. 22710279
386 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g27340.1

Sequence Viewer

Length: 345 bp
ATGCATTCACACACCAACAACCTAGCTCTTTTTCCATCATTATTTCATACACATGCACTCTCAATCATAACAACCACATTCACTCTTAAACAATCACCCACATATTCTCCCATTCCCCCTATAAATACCCTTGCATTCATTCATTCAAGGATCATCTCATTCACAACACAACACCCCTCAAACACTCCCATTCTTTCCTTACTTTCCATTTCCATCACTCCTCACTCCATTCCACACTTCCATTCCCCCAAACCAACTATCCTTAGACCTTATGCTACAACAACGAGGAAGAGAAGAGGACCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.84

Weight (kDa)

11.42

Isoelectric Point (pI)

65.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 307
AclWI GGATC 1 cut(s) 158
AgsI TTSAA 2 cut(s) 147, 321
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AlwI GGATC 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 1 cut(s) 87
AvaII GGWCC 1 cut(s) 299
BccI CCATC 2 cut(s) 43, 221
BfaI CTAG 1 cut(s) 23
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BsaXI ACNNNNNCTCC 2 cut(s) 91, 121
BseRI GAGGAG 1 cut(s) 210
BsmI GAATGC 2 cut(s) 4, 134
Bsp143I GATC 1 cut(s) 150
BspPI GGATC 1 cut(s) 158
BssMI GATC 1 cut(s) 150
Bst6I CTCTTC 2 cut(s) 284, 289
BstDEI CTNAG 1 cut(s) 263
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 299
CviAII CATG 1 cut(s) 53
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
DdeI CTNAG 1 cut(s) 263
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eam1104I CTCTTC 2 cut(s) 284, 289
EarI CTCTTC 2 cut(s) 284, 289
Eco47I GGWCC 1 cut(s) 299
EcoO109I RGGNCCY 1 cut(s) 299
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 56
FaiI YATR 7 cut(s) 48, 54, 68, 103, 122, 273, 313
FatI CATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 23
Hin1II CATG 1 cut(s) 56
HphI GGTGA 1 cut(s) 87
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 3 cut(s) 4, 56, 134
HpyF3I CTNAG 1 cut(s) 263
HpySE526I ACGT 1 cut(s) 307
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 23
MaeII ACGT 1 cut(s) 307
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 2 cut(s) 301, 306
MluCI AATT 1 cut(s) 316
MmeI TCCRAC 1 cut(s) 314
MnlI CCTC 4 cut(s) 187, 231, 279, 290
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 87
MslI CAYNNNNRTG 1 cut(s) 51
Mva1269I GAATGC 2 cut(s) 4, 134
NdeII GATC 1 cut(s) 150
NlaIII CATG 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 56
PctI GAATGC 2 cut(s) 4, 134
PpuMI RGGWCCY 1 cut(s) 299
Psp1406I AACGTT 1 cut(s) 307
Psp5II RGGWCCY 1 cut(s) 299
PspPI GGNCC 1 cut(s) 299
PspPPI RGGWCCY 1 cut(s) 299
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 299
SetI ASST 5 cut(s) 24, 28, 271, 304, 310
SgeI CNNG 6 cut(s) 35, 65, 143, 159, 297, 333
SinI GGWCC 1 cut(s) 299
SmiMI CAYNNNNRTG 1 cut(s) 51
Sse9I AATT 1 cut(s) 316
SspMI CTAG 1 cut(s) 23
TaiI ACGT 1 cut(s) 310
TasI AATT 1 cut(s) 316
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TspDTI ATGAA 4 cut(s) 35, 127, 131, 300
VpaK11BI GGWCC 1 cut(s) 299
XceI RCATGY 1 cut(s) 56
XspI CTAG 1 cut(s) 23
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.