pycom2328g00060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002328
OG0001078
Physical Location & Seq
Forward (+)
83096 .. 83609
514 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2328g00060.1

Sequence Viewer

Length: 474 bp
ATGCATTTATCATCATTCACCCTAGCTGTAATTCACATGCAAACACATTCATATCAGCCACATGCATCTCCCATCTCATTTCTATATTGTCCCCTTGCACATGCAGCCACTTATTCAAAGCACATGCATTTCCACCCTTTAATCACATGCATAAATCGGCCACATGCATCTCCCATCACCATTCCAGAATTCCACCACCCTCCTAGCTGTCATCCACAACCAGGGGGAGCCATTCACCACAGAAATAAGGCCTTTGTGCCAGAAAACCAACCATTCTCATTCACTCTTCCATTTCAGAAAATCATCCATACATTCAGAAATTCACCAAGCAACAAACCCCTTGTTGCCGTGCCTTCCCTATTAATCCAAACACCACTCCCCAAACCATTCACACCACCAAACCTCACCTTAGACCTTGTGCTACAACAACGAGGAAGAGAAGAGTGCCTAAACGTTCATACAATTCAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

158

Amino Acids

17.73

Weight (kDa)

9.3

Isoelectric Point (pI)

66.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 453
AcoI YGGCCR 1 cut(s) 158
AcsI RAATTY 2 cut(s) 188, 319
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 2 cut(s) 117, 467
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 2 cut(s) 26, 207
AluI AGCT 2 cut(s) 26, 207
AoxI GGCC 2 cut(s) 158, 249
ApeKI GCWGC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 188, 319
AseI ATTAAT 1 cut(s) 362
AsuHPI GGTGA 5 cut(s) 10, 169, 227, 315, 397
BbvI GCAGC 1 cut(s) 116
BccI CCATC 2 cut(s) 80, 182
BceAI ACGGC 1 cut(s) 332
BciT130I CCWGG 1 cut(s) 222
BfaI CTAG 2 cut(s) 23, 204
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 229
BmrFI CCNGG 1 cut(s) 222
BmsI GCATC 2 cut(s) 74, 176
BsaJI CCNNGG 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 221
BseBI CCWGG 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 221
BseGI GGATG 2 cut(s) 211, 303
BseLI CCNNNNNNNGG 1 cut(s) 221
BseXI GCAGC 1 cut(s) 116
BshFI GGCC 2 cut(s) 160, 251
BslFI GGGAC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 221
BsmFI GGGAC 1 cut(s) 75
BsnI GGCC 2 cut(s) 160, 251
BspANI GGCC 2 cut(s) 160, 251
BspLI GGNNCC 1 cut(s) 229
BssECI CCNNGG 1 cut(s) 221
Bst2UI CCWGG 1 cut(s) 222
Bst6I CTCTTC 3 cut(s) 291, 430, 435
BstDEI CTNAG 1 cut(s) 409
BstF5I GGATG 2 cut(s) 211, 303
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstNI CCWGG 1 cut(s) 222
BstNSI RCATGY 6 cut(s) 40, 65, 104, 127, 150, 167
BstSCI CCNGG 1 cut(s) 220
BstV1I GCAGC 1 cut(s) 116
BsuRI GGCC 2 cut(s) 160, 251
BtsCI GGATG 2 cut(s) 211, 303
CviAII CATG 6 cut(s) 37, 62, 101, 124, 147, 164
CviJI RGCY 7 cut(s) 26, 58, 107, 160, 207, 230, 251
CviKI_1 RGCY 7 cut(s) 26, 58, 107, 160, 207, 230, 251
DdeI CTNAG 1 cut(s) 409
EaeI YGGCCR 1 cut(s) 158
Eam1104I CTCTTC 3 cut(s) 291, 430, 435
EarI CTCTTC 3 cut(s) 291, 430, 435
Eco147I AGGCCT 1 cut(s) 251
EcoRI GAATTC 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 220
EcoT22I ATGCAT 5 cut(s) 6, 67, 129, 152, 169
FaeI CATG 6 cut(s) 40, 65, 104, 127, 150, 167
FaqI GGGAC 1 cut(s) 75
FatI CATG 6 cut(s) 36, 61, 100, 123, 146, 163
Fnu4HI GCNGC 1 cut(s) 105
FokI GGATG 2 cut(s) 198, 290
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 2 cut(s) 23, 204
GluI GCNGC 1 cut(s) 105
HaeIII GGCC 2 cut(s) 160, 251
Hin1II CATG 6 cut(s) 40, 65, 104, 127, 150, 167
HphI GGTGA 5 cut(s) 10, 169, 227, 315, 397
Hpy188I TCNGA 2 cut(s) 297, 317
Hpy188III TCNNGA 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 363
HpyCH4IV ACGT 1 cut(s) 453
HpyCH4V TGCA 8 cut(s) 4, 40, 65, 98, 104, 127, 150, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 409
HpySE526I ACGT 1 cut(s) 453
Hsp92II CATG 6 cut(s) 40, 65, 104, 127, 150, 167
LmnI GCTCC 1 cut(s) 227
LpnPI CCDG 4 cut(s) 198, 207, 234, 273
Lsp1109I GCAGC 1 cut(s) 116
LweI GCATC 2 cut(s) 74, 176
MaeI CTAG 2 cut(s) 23, 204
MaeII ACGT 1 cut(s) 453
MboII GAAGA 3 cut(s) 278, 447, 452
MluCI AATT 4 cut(s) 30, 188, 319, 462
MnlI CCTC 3 cut(s) 210, 413, 425
Mph1103I ATGCAT 5 cut(s) 6, 67, 129, 152, 169
MseI TTAA 2 cut(s) 140, 362
MspR9I CCNGG 1 cut(s) 222
MvaI CCWGG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 104
NlaIII CATG 6 cut(s) 40, 65, 104, 127, 150, 167
NlaIV GGNNCC 1 cut(s) 229
NsiI ATGCAT 5 cut(s) 6, 67, 129, 152, 169
NspI RCATGY 6 cut(s) 40, 65, 104, 127, 150, 167
PceI AGGCCT 1 cut(s) 251
PkrI GCNGC 1 cut(s) 106
PshBI ATTAAT 1 cut(s) 362
Psp1406I AACGTT 1 cut(s) 453
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 229
SaqAI TTAA 2 cut(s) 140, 362
SatI GCNGC 1 cut(s) 105
ScrFI CCNGG 1 cut(s) 222
SetI ASST 6 cut(s) 28, 209, 405, 410, 417, 456
SfaNI GCATC 2 cut(s) 74, 176
Sse9I AATT 4 cut(s) 30, 188, 319, 462
SseBI AGGCCT 1 cut(s) 251
SspMI CTAG 2 cut(s) 23, 204
StuI AGGCCT 1 cut(s) 251
StyD4I CCNGG 1 cut(s) 220
TaiI ACGT 1 cut(s) 456
TasI AATT 4 cut(s) 30, 188, 319, 462
Tru1I TTAA 2 cut(s) 140, 362
Tru9I TTAA 2 cut(s) 140, 362
TseI GCWGC 1 cut(s) 104
TspDTI ATGAA 2 cut(s) 39, 446
VspI ATTAAT 1 cut(s) 362
XapI RAATTY 2 cut(s) 188, 319
XceI RCATGY 6 cut(s) 40, 65, 104, 127, 150, 167
XspI CTAG 2 cut(s) 23, 204
Zsp2I ATGCAT 5 cut(s) 6, 67, 129, 152, 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.