pycom17g16580

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0001078
Physical Location & Seq
Forward (+)
14657728 .. 14657973
246 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g16580.1

Sequence Viewer

Length: 246 bp
ATGCATTCATCATCATTCACCCTAGCTTTAATTCACATGCAAACACATTCATTTTCAGCACCAAACGCCATCATTGACATGCACTCCCATTTTCTCCCAAAACATTGCACATGCATTCATAATCATTCACACCTTGCAGCCACTCCACATGCATTTCCAGCTTTCCACCAACCTCCTAGCTGTCATATTCCCTCTTTTTCACCTATAAATAAACATCCATTGCAGCCACATGCATTCCCCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.04

Weight (kDa)

7.94

Isoelectric Point (pI)

85.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 26, 161, 180
AluI AGCT 3 cut(s) 26, 161, 180
ApeKI GCWGC 2 cut(s) 137, 223
AsuHPI GGTGA 2 cut(s) 10, 192
BbvI GCAGC 2 cut(s) 149, 235
BccI CCATC 1 cut(s) 77
BfaI CTAG 2 cut(s) 23, 177
BisI GCNGC 2 cut(s) 138, 224
BlsI GCNGC 2 cut(s) 139, 225
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
Bse3DI GCAATG 2 cut(s) 103, 218
BseGI GGATG 1 cut(s) 214
BseMI GCAATG 2 cut(s) 103, 218
BseXI GCAGC 2 cut(s) 149, 235
BsmI GAATGC 3 cut(s) 4, 114, 233
BsrDI GCAATG 2 cut(s) 103, 218
BstF5I GGATG 1 cut(s) 214
BstMWI GCNNNNNNNGC 2 cut(s) 65, 158
BstNSI RCATGY 5 cut(s) 40, 82, 114, 152, 233
BstV1I GCAGC 2 cut(s) 149, 235
BtsCI GGATG 1 cut(s) 214
CviAII CATG 5 cut(s) 37, 79, 111, 149, 230
CviJI RGCY 5 cut(s) 26, 140, 161, 180, 226
CviKI_1 RGCY 5 cut(s) 26, 140, 161, 180, 226
EcoT22I ATGCAT 4 cut(s) 6, 116, 154, 235
FaeI CATG 5 cut(s) 40, 82, 114, 152, 233
FaiI YATR 8 cut(s) 38, 80, 112, 120, 150, 186, 206, 231
FatI CATG 5 cut(s) 36, 78, 110, 148, 229
Fnu4HI GCNGC 2 cut(s) 138, 224
FokI GGATG 1 cut(s) 201
Fsp4HI GCNGC 2 cut(s) 138, 224
FspBI CTAG 2 cut(s) 23, 177
GluI GCNGC 2 cut(s) 138, 224
Hin1II CATG 5 cut(s) 40, 82, 114, 152, 233
HphI GGTGA 2 cut(s) 10, 192
HpyCH4V TGCA 9 cut(s) 4, 40, 82, 108, 114, 137, 152, 223, 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 158
Hsp92II CATG 5 cut(s) 40, 82, 114, 152, 233
LpnPI CCDG 1 cut(s) 171
Lsp1109I GCAGC 2 cut(s) 149, 235
MaeI CTAG 2 cut(s) 23, 177
MluCI AATT 1 cut(s) 30
MnlI CCTC 2 cut(s) 183, 202
Mph1103I ATGCAT 4 cut(s) 6, 116, 154, 235
MseI TTAA 2 cut(s) 29, 244
MslI CAYNNNNRTG 1 cut(s) 77
Mva1269I GAATGC 3 cut(s) 4, 114, 233
MwoI GCNNNNNNNGC 2 cut(s) 65, 158
NlaIII CATG 5 cut(s) 40, 82, 114, 152, 233
NsiI ATGCAT 4 cut(s) 6, 116, 154, 235
NspI RCATGY 5 cut(s) 40, 82, 114, 152, 233
PctI GAATGC 3 cut(s) 4, 114, 233
PkrI GCNGC 2 cut(s) 139, 225
RseI CAYNNNNRTG 1 cut(s) 77
SaqAI TTAA 2 cut(s) 29, 244
SatI GCNGC 2 cut(s) 138, 224
SetI ASST 6 cut(s) 28, 135, 163, 175, 182, 205
SgeI CNNG 9 cut(s) 35, 49, 91, 123, 146, 161, 170, 189, 242
SmiMI CAYNNNNRTG 1 cut(s) 77
Sse9I AATT 1 cut(s) 30
SspMI CTAG 2 cut(s) 23, 177
TasI AATT 1 cut(s) 30
Tru1I TTAA 2 cut(s) 29, 244
Tru9I TTAA 2 cut(s) 29, 244
TseI GCWGC 2 cut(s) 137, 223
TspDTI ATGAA 2 cut(s) 39, 107
XceI RCATGY 5 cut(s) 40, 82, 114, 152, 233
XspI CTAG 2 cut(s) 23, 177
Zsp2I ATGCAT 4 cut(s) 6, 116, 154, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.