pycom12g01970

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
1661723 .. 1661914
192 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g01970.1

Sequence Viewer

Length: 192 bp
ATGTTCCCCCCATTTCACCTAATTATAAGCATCCATTCCATTCATTCTCATTCATTCTTCCACATTTCAGAAAATCATCTATTCACACCAAGAAACATCCCCTTGGCCGTGAGTTTCCCTACAAATCCAAACACCACTCCTCTTCCATTTCCATCACTCCCCAAACCATTCACACCATCAAACTATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.18

Weight (kDa)

8.45

Isoelectric Point (pI)

61.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 26
AcoI YGGCCR 1 cut(s) 105
AoxI GGCC 1 cut(s) 105
AsuHPI GGTGA 1 cut(s) 8
BccI CCATC 2 cut(s) 160, 184
BceAI ACGGC 1 cut(s) 92
BmsI GCATC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 102
BseGI GGATG 2 cut(s) 30, 96
BseRI GAGGAG 1 cut(s) 129
BshFI GGCC 1 cut(s) 107
BsnI GGCC 1 cut(s) 107
BspANI GGCC 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 102
Bst6I CTCTTC 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 189
BstF5I GGATG 2 cut(s) 30, 96
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 2 cut(s) 30, 96
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DdeI CTNAG 1 cut(s) 189
EaeI YGGCCR 1 cut(s) 105
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaiI YATR 1 cut(s) 26
FokI GGATG 2 cut(s) 17, 83
HaeIII GGCC 1 cut(s) 107
HphI GGTGA 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 189
LweI GCATC 1 cut(s) 39
MboII GAAGA 2 cut(s) 49, 134
MluCI AATT 1 cut(s) 21
MnlI CCTC 1 cut(s) 150
PsiI TTATAA 1 cut(s) 26
SetI ASST 1 cut(s) 21
SfaNI GCATC 1 cut(s) 39
SgeI CNNG 3 cut(s) 102, 115, 121
Sse9I AATT 1 cut(s) 21
StyI CCWWGG 1 cut(s) 102
TasI AATT 1 cut(s) 21
TspDTI ATGAA 2 cut(s) 32, 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.