pycom05g07480

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
10436345 .. 10437040
696 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g07480.1

Sequence Viewer

Length: 696 bp
ATGCATTTTGGACATAAAACAAAGGGCCTAGCCCAATCAAACAATCCTTTGAGCCATGCAAAACCTCTAGCCCAATCAACAACCCTTAGCCACATGCATACACACACATGCACTTATTCTTTCATCATTACACCACCATTCACACACACATGCACTTACTCTTTCACACACACATGCACTTACTCTTTCATCATTGCACCACCATTCACACACACATGCACTTACTCTTTCACACACACATGCACTTACTCTTTCATCATTGCACCACCATTCACACACACATGCACTTACTCTTTCATCATTGCACCACCAATTCAACACATGCATTCACACACCAACAACCTAGCTCTTTTTCCATCATTATTTCATCCACATGCACTCTCAATCATAACAACCACATTCACTCTTAAACAATCACCCACATATTCTCCCATTCCCCCTATAAATACCCTTGCATTCATTCATTCAAGCATCATCTCATTCACAACACAACACCCCTCAAACACTTCCATTCTTCTCTTTGCCGTGAGTCCCCTTAGAATCCAAAACCATCTTTCCATTTCCATCACTCCTCACTCCATTCCACACTTCCATTCCCCCAAACCAACTATCCTTAGACCTTATGCTACAATAAAGAGGAAGAGAAGAGGGCCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

232

Amino Acids

26.02

Weight (kDa)

9.83

Isoelectric Point (pI)

64.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 658
AgsI TTSAA 3 cut(s) 317, 468, 672
AluBI AGCT 1 cut(s) 347
AluI AGCT 1 cut(s) 347
AoxI GGCC 2 cut(s) 25, 650
AspS9I GGNCC 2 cut(s) 25, 650
AsuHPI GGTGA 1 cut(s) 408
BccI CCATC 3 cut(s) 364, 558, 572
BceAI ACGGC 1 cut(s) 509
BfaI CTAG 3 cut(s) 29, 68, 344
BmgT120I GGNCC 2 cut(s) 25, 650
BmsI GCATC 1 cut(s) 480
Bpu10I CCTNAGC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 412, 442
Bse3DI GCAATG 3 cut(s) 192, 258, 300
BseGI GGATG 1 cut(s) 367
BseMI GCAATG 3 cut(s) 192, 258, 300
BseRI GAGGAG 1 cut(s) 561
BshFI GGCC 2 cut(s) 27, 652
BslFI GGGAC 1 cut(s) 516
BsmFI GGGAC 1 cut(s) 516
BsmI GAATGC 2 cut(s) 325, 455
BsnI GGCC 2 cut(s) 27, 652
BspANI GGCC 2 cut(s) 27, 652
BsrDI GCAATG 3 cut(s) 192, 258, 300
Bst6I CTCTTC 2 cut(s) 635, 640
BstDEI CTNAG 3 cut(s) 86, 536, 614
BstF5I GGATG 1 cut(s) 367
BstNSI RCATGY 9 cut(s) 97, 111, 153, 177, 219, 243, 285, 325, 377
BsuRI GGCC 2 cut(s) 27, 652
BtsCI GGATG 1 cut(s) 367
Cfr13I GGNCC 2 cut(s) 25, 650
CviJI RGCY 7 cut(s) 27, 32, 54, 71, 90, 347, 652
CviKI_1 RGCY 7 cut(s) 27, 32, 54, 71, 90, 347, 652
DdeI CTNAG 3 cut(s) 86, 536, 614
Eam1104I CTCTTC 2 cut(s) 635, 640
EarI CTCTTC 2 cut(s) 635, 640
EcoO109I RGGNCCY 2 cut(s) 25, 650
EcoT22I ATGCAT 3 cut(s) 6, 99, 327
FaqI GGGAC 1 cut(s) 516
FokI GGATG 1 cut(s) 354
FspBI CTAG 3 cut(s) 29, 68, 344
HaeIII GGCC 2 cut(s) 27, 652
HinfI GANTC 2 cut(s) 529, 540
HphI GGTGA 1 cut(s) 408
HpyCH4IV ACGT 1 cut(s) 658
HpyF3I CTNAG 3 cut(s) 86, 536, 614
HpySE526I ACGT 1 cut(s) 658
LweI GCATC 1 cut(s) 480
MaeI CTAG 3 cut(s) 29, 68, 344
MaeII ACGT 1 cut(s) 658
MboII GAAGA 3 cut(s) 506, 652, 657
MluCI AATT 2 cut(s) 312, 667
MlyI GAGTC 1 cut(s) 538
MmeI TCCRAC 1 cut(s) 665
MnlI CCTC 5 cut(s) 75, 508, 582, 630, 641
Mph1103I ATGCAT 3 cut(s) 6, 99, 327
MseI TTAA 1 cut(s) 408
MslI CAYNNNNRTG 7 cut(s) 106, 148, 172, 214, 238, 280, 372
Mva1269I GAATGC 2 cut(s) 325, 455
NsiI ATGCAT 3 cut(s) 6, 99, 327
NspI RCATGY 9 cut(s) 97, 111, 153, 177, 219, 243, 285, 325, 377
PctI GAATGC 2 cut(s) 325, 455
PfeI GAWTC 1 cut(s) 540
PleI GAGTC 1 cut(s) 537
PpsI GAGTC 1 cut(s) 537
Psp1406I AACGTT 1 cut(s) 658
PspPI GGNCC 2 cut(s) 25, 650
RseI CAYNNNNRTG 7 cut(s) 106, 148, 172, 214, 238, 280, 372
SaqAI TTAA 1 cut(s) 408
Sau96I GGNCC 2 cut(s) 25, 650
SchI GAGTC 1 cut(s) 538
SetI ASST 5 cut(s) 67, 345, 349, 622, 661
SfaNI GCATC 1 cut(s) 480
SmiMI CAYNNNNRTG 7 cut(s) 106, 148, 172, 214, 238, 280, 372
Sse9I AATT 2 cut(s) 312, 667
SspMI CTAG 3 cut(s) 29, 68, 344
TaiI ACGT 1 cut(s) 661
TasI AATT 2 cut(s) 312, 667
TfiI GAWTC 1 cut(s) 540
Tru1I TTAA 1 cut(s) 408
Tru9I TTAA 1 cut(s) 408
TspDTI ATGAA 8 cut(s) 112, 178, 244, 286, 356, 448, 452, 651
XceI RCATGY 9 cut(s) 97, 111, 153, 177, 219, 243, 285, 325, 377
XspI CTAG 3 cut(s) 29, 68, 344
Zsp2I ATGCAT 3 cut(s) 6, 99, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.