pycom12463g00050

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012463
Physical Location & Seq
Reverse (-)
21516 .. 21713
198 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12463g00050.1

Sequence Viewer

Length: 198 bp
ATGCTCTCCCATTTCAGATTGCATTCCCACTCACCACAAATCAGCCACATGCATTTTGCCTTTCATCATTGCATCACAAATCAGCCACATGCACTTTTCCTTTCATCATTGCACCACAAATCAGCCACATGCACATTTCCTTTCATCATTGCACCACAAATCAGCCACATGCACATTCACCCCTTTCTCCACCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.59

Weight (kDa)

8.95

Isoelectric Point (pI)

70.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AsuHPI GGTGA 2 cut(s) 24, 170
BmsI GCATC 1 cut(s) 81
Bse3DI GCAATG 3 cut(s) 67, 107, 147
BseMI GCAATG 3 cut(s) 67, 107, 147
BsmI GAATGC 1 cut(s) 22
BsrDI GCAATG 3 cut(s) 67, 107, 147
BstNSI RCATGY 4 cut(s) 52, 92, 132, 172
CviAII CATG 4 cut(s) 49, 89, 129, 169
CviJI RGCY 4 cut(s) 45, 85, 125, 165
CviKI_1 RGCY 4 cut(s) 45, 85, 125, 165
EcoT22I ATGCAT 1 cut(s) 54
FaeI CATG 4 cut(s) 52, 92, 132, 172
FaiI YATR 5 cut(s) 50, 90, 130, 170, 196
FatI CATG 4 cut(s) 48, 88, 128, 168
Hin1II CATG 4 cut(s) 52, 92, 132, 172
HphI GGTGA 2 cut(s) 24, 170
Hpy188I TCNGA 1 cut(s) 17
HpyCH4V TGCA 8 cut(s) 22, 52, 72, 92, 112, 132, 152, 172
Hsp92II CATG 4 cut(s) 52, 92, 132, 172
LweI GCATC 1 cut(s) 81
Mph1103I ATGCAT 1 cut(s) 54
Mva1269I GAATGC 1 cut(s) 22
NlaIII CATG 4 cut(s) 52, 92, 132, 172
NsiI ATGCAT 1 cut(s) 54
NspI RCATGY 4 cut(s) 52, 92, 132, 172
PctI GAATGC 1 cut(s) 22
SetI ASST 1 cut(s) 195
SfaNI GCATC 1 cut(s) 81
SgeI CNNG 4 cut(s) 61, 101, 141, 181
TspDTI ATGAA 3 cut(s) 53, 93, 133
XceI RCATGY 4 cut(s) 52, 92, 132, 172
Zsp2I ATGCAT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.