pycom808g00470

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000808
Physical Location & Seq
Forward (+)
273566 .. 274251
686 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom808g00470.1

Sequence Viewer

Length: 645 bp
ATGCACTTTGGACATAAAACAAAGGGCCTAGCCCAATCAAACAATCCTTTGAGCCATGCAAAACCTCTAGCCCAATCAACAACCCTTAGCCACATGCATTCACATGCATCACAACCCCAAAACCATCAAGAAACACCATTCACACACACATGCACTTACTCTTTCATCATTGCACCACCATTCACACACACATGCACTTATTCTTTCATCATTACACCACCATTCACACACACATGCACTTACTCTTTCACACATACATGCACTTACTCTTTCATCATTGCACCACCATTCACACACACATGCACTTACTCTTTCATCATTGCACCACCAATTCAACACATGCATTCACACACCAACAACCTAGCTCTTTTTCCATCATTATTTCATCCACATGCACTCTCAATCATAACAACCACATTCACTCTTAAACAATCACCCACATATTCTCCCATTCCCCCTATAAAAACCCATGCATTCATACACAAAAATATCATCTCATTTTTCATACACAACACACAACACAAAATCCTTCATTCTTTCCAACCACTCCAACCACTCCTCATCCCCCAAAAACTCACCTTAGACCTTGTGCTACAACAACGAAGAAGAGAAGAGTGCCTAAACGTTCATACAATTCAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

215

Amino Acids

24.43

Weight (kDa)

9.26

Isoelectric Point (pI)

71.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 624
AgsI TTSAA 2 cut(s) 335, 638
AluBI AGCT 1 cut(s) 365
AluI AGCT 1 cut(s) 365
AoxI GGCC 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 25
AsuHPI GGTGA 2 cut(s) 426, 568
BccI CCATC 2 cut(s) 132, 382
BfaI CTAG 3 cut(s) 29, 68, 362
BmgT120I GGNCC 1 cut(s) 25
BmsI GCATC 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 430, 460
Bse3DI GCAATG 3 cut(s) 168, 276, 318
BseGI GGATG 2 cut(s) 385, 561
BseMI GCAATG 3 cut(s) 168, 276, 318
BseRI GAGGAG 1 cut(s) 548
BshFI GGCC 1 cut(s) 27
BsmI GAATGC 3 cut(s) 97, 343, 473
BsnI GGCC 1 cut(s) 27
BspANI GGCC 1 cut(s) 27
BsrDI GCAATG 3 cut(s) 168, 276, 318
Bst6I CTCTTC 2 cut(s) 601, 606
BstDEI CTNAG 2 cut(s) 86, 580
BstF5I GGATG 2 cut(s) 385, 561
BstNSI RCATGY 9 cut(s) 97, 107, 153, 195, 237, 261, 303, 343, 395
BsuRI GGCC 1 cut(s) 27
BtsCI GGATG 2 cut(s) 385, 561
Cfr13I GGNCC 1 cut(s) 25
CviJI RGCY 6 cut(s) 27, 32, 54, 71, 90, 365
CviKI_1 RGCY 6 cut(s) 27, 32, 54, 71, 90, 365
DdeI CTNAG 2 cut(s) 86, 580
Eam1104I CTCTTC 2 cut(s) 601, 606
EarI CTCTTC 2 cut(s) 601, 606
EcoO109I RGGNCCY 1 cut(s) 25
EcoT22I ATGCAT 4 cut(s) 99, 109, 345, 475
FokI GGATG 2 cut(s) 372, 548
FspBI CTAG 3 cut(s) 29, 68, 362
HaeIII GGCC 1 cut(s) 27
HphI GGTGA 2 cut(s) 426, 568
Hpy188III TCNNGA 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 539
HpyCH4IV ACGT 1 cut(s) 624
HpyF3I CTNAG 2 cut(s) 86, 580
HpySE526I ACGT 1 cut(s) 624
LweI GCATC 1 cut(s) 116
MaeI CTAG 3 cut(s) 29, 68, 362
MaeII ACGT 1 cut(s) 624
MboII GAAGA 3 cut(s) 615, 618, 623
MluCI AATT 2 cut(s) 330, 633
MmeI TCCRAC 2 cut(s) 565, 574
MnlI CCTC 2 cut(s) 75, 569
Mph1103I ATGCAT 4 cut(s) 99, 109, 345, 475
MseI TTAA 1 cut(s) 426
MslI CAYNNNNRTG 7 cut(s) 102, 148, 190, 232, 256, 298, 390
Mva1269I GAATGC 3 cut(s) 97, 343, 473
NsiI ATGCAT 4 cut(s) 99, 109, 345, 475
NspI RCATGY 9 cut(s) 97, 107, 153, 195, 237, 261, 303, 343, 395
PctI GAATGC 3 cut(s) 97, 343, 473
Psp1406I AACGTT 1 cut(s) 624
PspPI GGNCC 1 cut(s) 25
RseI CAYNNNNRTG 7 cut(s) 102, 148, 190, 232, 256, 298, 390
SaqAI TTAA 1 cut(s) 426
Sau96I GGNCC 1 cut(s) 25
SetI ASST 6 cut(s) 67, 363, 367, 581, 588, 627
SfaNI GCATC 1 cut(s) 116
SmiMI CAYNNNNRTG 7 cut(s) 102, 148, 190, 232, 256, 298, 390
Sse9I AATT 2 cut(s) 330, 633
SspMI CTAG 3 cut(s) 29, 68, 362
TaiI ACGT 1 cut(s) 627
TasI AATT 2 cut(s) 330, 633
Tru1I TTAA 1 cut(s) 426
Tru9I TTAA 1 cut(s) 426
TspDTI ATGAA 9 cut(s) 154, 196, 262, 304, 374, 466, 493, 521, 617
XceI RCATGY 9 cut(s) 97, 107, 153, 195, 237, 261, 303, 343, 395
XspI CTAG 3 cut(s) 29, 68, 362
Zsp2I ATGCAT 4 cut(s) 99, 109, 345, 475
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.