pycom17g17860

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
15413922 .. 15414296
375 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g17860.1

Sequence Viewer

Length: 375 bp
ATGCATTCCCACCCTTTAATCACATGCATAAATCAGCCACATGCATCTCCCATCACCATTTCAGATTTCCACCAAGTTCCTAGCTGTCATGTTCCCTCTCTTTCTCCCTATAAATACCATACACACTTCACACAACATTCATTCATTCTCATTCACTCTTCCATATTCCAGAAATTCGTCAAAACCTCTCCACACCCTTGCAGCAGCCACCAAAACACTTTTCTCCTCCATTGCAGCCACTCCAACCACTCCCCATCCCTCCAAAACACTTCACACTATCCCAAAACACACCTTAGACATTGTGATACAACGAAGAGGAAGATAAGAGGGCCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.27

Weight (kDa)

9.61

Isoelectric Point (pI)

69.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 337
AcsI RAATTY 1 cut(s) 173
AgsI TTSAA 1 cut(s) 351
AjuI GAANNNNNNNTTGG 2 cut(s) 204, 236
AluBI AGCT 1 cut(s) 84
AluI AGCT 1 cut(s) 84
AoxI GGCC 1 cut(s) 329
ApeKI GCWGC 3 cut(s) 201, 204, 234
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 329
AsuHPI GGTGA 1 cut(s) 46
BbvI GCAGC 3 cut(s) 213, 216, 246
BccI CCATC 2 cut(s) 59, 262
BfaI CTAG 1 cut(s) 81
BisI GCNGC 3 cut(s) 202, 205, 235
BlsI GCNGC 3 cut(s) 203, 206, 236
BmgT120I GGNCC 1 cut(s) 329
BmsI GCATC 1 cut(s) 53
Bse3DI GCAATG 1 cut(s) 229
BseGI GGATG 1 cut(s) 254
BseMI GCAATG 1 cut(s) 229
BseRI GAGGAG 1 cut(s) 215
BseXI GCAGC 3 cut(s) 213, 216, 246
BshFI GGCC 1 cut(s) 331
BsmI GAATGC 1 cut(s) 4
BsnI GGCC 1 cut(s) 331
BspANI GGCC 1 cut(s) 331
BsrDI GCAATG 1 cut(s) 229
Bst6I CTCTTC 2 cut(s) 163, 308
BstDEI CTNAG 1 cut(s) 293
BstF5I GGATG 1 cut(s) 254
BstNSI RCATGY 2 cut(s) 27, 44
BstV1I GCAGC 3 cut(s) 213, 216, 246
BsuRI GGCC 1 cut(s) 331
BtsCI GGATG 1 cut(s) 254
Cfr13I GGNCC 1 cut(s) 329
CviAII CATG 3 cut(s) 24, 41, 89
CviJI RGCY 5 cut(s) 37, 84, 207, 237, 331
CviKI_1 RGCY 5 cut(s) 37, 84, 207, 237, 331
DdeI CTNAG 1 cut(s) 293
Eam1104I CTCTTC 2 cut(s) 163, 308
EarI CTCTTC 2 cut(s) 163, 308
EcoO109I RGGNCCY 1 cut(s) 329
EcoT22I ATGCAT 3 cut(s) 6, 29, 46
FaeI CATG 3 cut(s) 27, 44, 92
FaiI YATR 8 cut(s) 25, 29, 42, 90, 111, 120, 164, 343
FatI CATG 3 cut(s) 23, 40, 88
Fnu4HI GCNGC 3 cut(s) 202, 205, 235
FokI GGATG 1 cut(s) 241
Fsp4HI GCNGC 3 cut(s) 202, 205, 235
FspBI CTAG 1 cut(s) 81
GluI GCNGC 3 cut(s) 202, 205, 235
HaeIII GGCC 1 cut(s) 331
Hin1II CATG 3 cut(s) 27, 44, 92
HphI GGTGA 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 169
HpyCH4IV ACGT 1 cut(s) 337
HpyCH4V TGCA 5 cut(s) 4, 27, 44, 201, 234
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 1 cut(s) 337
Hsp92II CATG 3 cut(s) 27, 44, 92
LpnPI CCDG 1 cut(s) 182
Lsp1109I GCAGC 3 cut(s) 213, 216, 246
LweI GCATC 1 cut(s) 53
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 337
MboII GAAGA 3 cut(s) 150, 325, 331
MluCI AATT 2 cut(s) 173, 346
MmeI TCCRAC 2 cut(s) 267, 344
MnlI CCTC 6 cut(s) 106, 196, 236, 269, 309, 320
Mph1103I ATGCAT 3 cut(s) 6, 29, 46
MseI TTAA 1 cut(s) 17
Mva1269I GAATGC 1 cut(s) 4
NlaIII CATG 3 cut(s) 27, 44, 92
NsiI ATGCAT 3 cut(s) 6, 29, 46
NspI RCATGY 2 cut(s) 27, 44
PctI GAATGC 1 cut(s) 4
PkrI GCNGC 3 cut(s) 203, 206, 236
Psp1406I AACGTT 1 cut(s) 337
PspPI GGNCC 1 cut(s) 329
SaqAI TTAA 1 cut(s) 17
SatI GCNGC 3 cut(s) 202, 205, 235
Sau96I GGNCC 1 cut(s) 329
SetI ASST 4 cut(s) 86, 188, 294, 340
SfaNI GCATC 1 cut(s) 53
SgeI CNNG 8 cut(s) 36, 53, 86, 93, 101, 181, 210, 363
Sse9I AATT 2 cut(s) 173, 346
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 340
TasI AATT 2 cut(s) 173, 346
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TseI GCWGC 3 cut(s) 201, 204, 234
TspDTI ATGAA 3 cut(s) 129, 133, 330
XapI RAATTY 1 cut(s) 173
XceI RCATGY 2 cut(s) 27, 44
XspI CTAG 1 cut(s) 81
Zsp2I ATGCAT 3 cut(s) 6, 29, 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.